Detailed information of oriT
oriT
The information of the oriT region
oriTDB ID | 101817 |
Name | oriT_ECL402|unnamed76 |
Organism | Enterobacter asburiae strain ECL402 |
Sequence Completeness | - |
NCBI accession of oriT (coordinates [strand]) | NZ_JAMYDH010000131 (138..196 [-], 59 nt) |
oriT length | 59 nt |
IRs (inverted repeats) | _ |
Location of nic site | _ |
Conserved sequence flanking the nic site |
_ |
Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 59 nt
>oriT_ECL402|unnamed76
GGTTTCGGGGCGCAGCCCTGAACCAGTCACGTAGCGCTAGCGGAGTGTATACTGGCTTA
GGTTTCGGGGCGCAGCCCTGAACCAGTCACGTAGCGCTAGCGGAGTGTATACTGGCTTA
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure fileHost bacterium
ID | 2261 | GenBank | NZ_JAMYDH010000131 |
Plasmid name | ECL402|unnamed76 | Incompatibility group | - |
Plasmid size | 253 bp | Coordinate of oriT [Strand] | 138..196 [-] |
Host baterium | Enterobacter asburiae strain ECL402 |
Cargo genes
Drug resistance gene | - |
Virulence gene | - |
Metal resistance gene | - |
Degradation gene | - |
Symbiosis gene | - |
Anti-CRISPR | - |