Detailed information of oriT

oriT


The information of the oriT region


oriTDB ID   101810
Name   oriT_CF4|unnamed2 in_silico
Organism   Enterobacter hormaechei strain CF4
Sequence Completeness      -
NCBI accession of oriT (coordinates [strand])   NZ_JACGFZ010000015 (25605..25703 [-], 99 nt)
oriT length   99 nt
IRs (inverted repeats)      77..82, 89..94  (AAAAAA..TTTTTT)
 77..82, 88..93  (AAAAAA..TTTTTT)
 31..38, 41..48  (AGCGTGAT..ATCACGCT)
 17..23, 35..41  (TAAATCA..TGATTTA)
Location of nic site      59..60
Conserved sequence flanking the
  nic site  
 
 GGTGTATAGC
Note   Predicted by oriTfinder 2.0

  oriT sequence  


Download         Length: 99 nt

>oriT_CF4|unnamed2
TTTGTTTTTTTTCTTTTAAATCAGTGCGATAGCGTGATTTATCACGCTGCGTTAGGTGTATAGCAGGTTAAGGGATAAAAAATCATCTTTTTTTGGTAG

Visualization of oriT structure

  oriT secondary structure

Predicted by RNAfold.

Download structure file


Host bacterium


ID   2254 GenBank   NZ_JACGFZ010000015
Plasmid name   CF4|unnamed2 Incompatibility group   IncR
Plasmid size   32025 bp Coordinate of oriT [Strand]   25605..25703 [-]
Host baterium   Enterobacter hormaechei strain CF4

Cargo genes


Drug resistance gene   aph(6)-Id, aph(3'')-Ib, tet(A)
Virulence gene   -
Metal resistance gene   -
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   -