Detailed information of oriT

oriT


The information of the oriT region


oriTDB ID   101791
Name   oriT1_pSauR90 in_silico
Organism   Staphylococcus aureus strain SauR90
Sequence Completeness      -
NCBI accession of oriT (coordinates [strand])   NZ_JAIVEI020000038 (11808..12047 [+], 240 nt)
oriT length   240 nt
IRs (inverted repeats)      217..222, 232..237  (ATTTTA..TAAAAT)
 171..178, 183..190  (CTATCATT..AATGATAG)
 154..160, 164..170  (GTCTGGC..GCCAGAC)
 37..42, 45..50  (TTTTTT..AAAAAA)
 36..41, 45..50  (TTTTTT..AAAAAA)
 1..7, 20..26  (AAGACAT..ATGTCTT)
Location of nic site      _
Conserved sequence flanking the
  nic site  
 
 _
Note   Predicted by oriTfinder 2.0

  oriT sequence  


Download         Length: 240 nt

>oriT1_pSauR90
AAGACATTAGTGATAACTGATGTCTTTTTTGTTGATTTTTTTGTAAAAAAGTACTGTCTTATTTTTGTGACAAATGCTGTATGTAGTGTCACAAAAGTGTGACACTACAGCTTTGTATGATATCACTTTAAAATTACTTAAAACCCTTGGAATGTCTGGCTTTGCCAGACCTATCATTTTTGAATGATAGCAAATTTCCCTTATGCTCTTACGGAGATTTTAGAGTTAAATTAAAATTTC

Visualization of oriT structure

  oriT secondary structure

Predicted by RNAfold.

Download structure file


Host bacterium


ID   2235 GenBank   NZ_JAIVEI020000038
Plasmid name   pSauR90 Incompatibility group   -
Plasmid size   22435 bp Coordinate of oriT [Strand]   11808..12047 [+]; 2377..2611 [-]
Host baterium   Staphylococcus aureus strain SauR90

Cargo genes


Drug resistance gene   -
Virulence gene   -
Metal resistance gene   -
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   AcrIIA21