Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 101789 |
| Name | oriT_pRspCCGE510a  |
| Organism | Rhizobium sp. CCGE 510 |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | NZ_AEYF01000065 (184..239 [+], 56 nt) |
| oriT length | 56 nt |
| IRs (inverted repeats) | 24..29, 34..39 (CGTCGC..GCGACG) |
| Location of nic site | _ |
| Conserved sequence flanking the nic site |
_ |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 56 nt
>oriT_pRspCCGE510a
CCCCGCCGGGGTGGCAAACAGCCCGTCGCGACAGCGACGTATAATTGCGCCCTTGG
CCCCGCCGGGGTGGCAAACAGCCCGTCGCGACAGCGACGTATAATTGCGCCCTTGG
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
Host bacterium
| ID | 2233 | GenBank | NZ_AEYF01000065 |
| Plasmid name | pRspCCGE510a | Incompatibility group | - |
| Plasmid size | 1273 bp | Coordinate of oriT [Strand] | 184..239 [+] |
| Host baterium | Rhizobium sp. CCGE 510 |
Cargo genes
| Drug resistance gene | - |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |