Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 101783 |
| Name | oriT_p2018n0381090_4  |
| Organism | Escherichia coli strain COL7 |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | NZ_JACYGF010000008 (1049..1109 [-], 61 nt) |
| oriT length | 61 nt |
| IRs (inverted repeats) | _ |
| Location of nic site | _ |
| Conserved sequence flanking the nic site |
_ |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 61 nt
>oriT_p2018n0381090_4
GGGTGTCGGGGCGCAGCCCTGACCCAGTTCACAGAGCGATAGCGATGTGTATACTGGCTTA
GGGTGTCGGGGCGCAGCCCTGACCCAGTTCACAGAGCGATAGCGATGTGTATACTGGCTTA
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
Host bacterium
| ID | 2227 | GenBank | NZ_JACYGF010000008 |
| Plasmid name | p2018n0381090_4 | Incompatibility group | - |
| Plasmid size | 3371 bp | Coordinate of oriT [Strand] | 1049..1109 [-] |
| Host baterium | Escherichia coli strain COL7 |
Cargo genes
| Drug resistance gene | - |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |