Detailed information of oriT

oriT


The information of the oriT region


oriTDB ID   101783
Name   oriT_p2018n0381090_4 in_silico
Organism   Escherichia coli strain COL7
Sequence Completeness      -
NCBI accession of oriT (coordinates [strand])   NZ_JACYGF010000008 (1049..1109 [-], 61 nt)
oriT length   61 nt
IRs (inverted repeats)     _
Location of nic site      _
Conserved sequence flanking the
  nic site  
 
 _
Note   Predicted by oriTfinder 2.0

  oriT sequence  


Download         Length: 61 nt

>oriT_p2018n0381090_4
GGGTGTCGGGGCGCAGCCCTGACCCAGTTCACAGAGCGATAGCGATGTGTATACTGGCTTA

Visualization of oriT structure

  oriT secondary structure

Predicted by RNAfold.

Download structure file


Host bacterium


ID   2227 GenBank   NZ_JACYGF010000008
Plasmid name   p2018n0381090_4 Incompatibility group   -
Plasmid size   3371 bp Coordinate of oriT [Strand]   1049..1109 [-]
Host baterium   Escherichia coli strain COL7

Cargo genes


Drug resistance gene   -
Virulence gene   -
Metal resistance gene   -
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   -