Detailed information of oriT

oriT


The information of the oriT region


oriTDB ID   101782
Name   oriT_p2018n0381090_3 in_silico
Organism   Escherichia coli strain COL7
Sequence Completeness      -
NCBI accession of oriT (coordinates [strand])   NZ_JACYGF010000006 (943..1002 [+], 60 nt)
oriT length   60 nt
IRs (inverted repeats)     _
Location of nic site      _
Conserved sequence flanking the
  nic site  
 
 _
Note   Predicted by oriTfinder 2.0

  oriT sequence  


Download         Length: 60 nt

>oriT_p2018n0381090_3
GGGTGTCGGGGCGCAGCCCTGACCCAGTCACGTAGCGATAGCGGAGTGTATACTGGCTTA

Visualization of oriT structure

  oriT secondary structure

Predicted by RNAfold.

Download structure file


Host bacterium


ID   2226 GenBank   NZ_JACYGF010000006
Plasmid name   p2018n0381090_3 Incompatibility group   -
Plasmid size   3691 bp Coordinate of oriT [Strand]   943..1002 [+]
Host baterium   Escherichia coli strain COL7

Cargo genes


Drug resistance gene   -
Virulence gene   -
Metal resistance gene   -
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   -