Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 101773 |
| Name | oriT_pA6sk3_1  |
| Organism | Klebsiella michiganensis strain CPE6 |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | NZ_JACYGP010000001 (900..959 [+], 60 nt) |
| oriT length | 60 nt |
| IRs (inverted repeats) | _ |
| Location of nic site | _ |
| Conserved sequence flanking the nic site |
_ |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 60 nt
>oriT_pA6sk3_1
GGGTTTCGGGGCGCAGCCCTGAACCAGTCACGTAGCGCTAGCGGAGTGTATACTGGCTTA
GGGTTTCGGGGCGCAGCCCTGAACCAGTCACGTAGCGCTAGCGGAGTGTATACTGGCTTA
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
Host bacterium
| ID | 2217 | GenBank | NZ_JACYGP010000001 |
| Plasmid name | pA6sk3_1 | Incompatibility group | Col440II |
| Plasmid size | 5219 bp | Coordinate of oriT [Strand] | 900..959 [+] |
| Host baterium | Klebsiella michiganensis strain CPE6 |
Cargo genes
| Drug resistance gene | - |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |