Detailed information of oriT

oriT


The information of the oriT region


oriTDB ID   101766
Name   oriT_pRHBSTW-00178_4 in_silico
Organism   Klebsiella oxytoca strain RHBSTW-00178
Sequence Completeness      -
NCBI accession of oriT (coordinates [strand])   NZ_JABXQZ010000004 (3287..3346 [+], 60 nt)
oriT length   60 nt
IRs (inverted repeats)     _
Location of nic site      _
Conserved sequence flanking the
  nic site  
 
 _
Note   Predicted by oriTfinder 2.0

  oriT sequence  


Download         Length: 60 nt

>oriT_pRHBSTW-00178_4
GGGTTTCGGGGCGCAGCCCTGAACCAGTCACGTAGCGCTAGCGGAGTGTATACTGGCTTA

Visualization of oriT structure

  oriT secondary structure

Predicted by RNAfold.

Download structure file


Host bacterium


ID   2210 GenBank   NZ_JABXQZ010000004
Plasmid name   pRHBSTW-00178_4 Incompatibility group   Col440II
Plasmid size   4096 bp Coordinate of oriT [Strand]   3287..3346 [+]
Host baterium   Klebsiella oxytoca strain RHBSTW-00178

Cargo genes


Drug resistance gene   -
Virulence gene   -
Metal resistance gene   -
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   -