Detailed information of oriT
oriT
The information of the oriT region
oriTDB ID | 101762 |
Name | oriT_pRHBSTW-00215_6 |
Organism | Klebsiella sp. RHBSTW-00215 |
Sequence Completeness | - |
NCBI accession of oriT (coordinates [strand]) | NZ_JABXQS010000006 (2933..2992 [+], 60 nt) |
oriT length | 60 nt |
IRs (inverted repeats) | _ |
Location of nic site | _ |
Conserved sequence flanking the nic site |
_ |
Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 60 nt
>oriT_pRHBSTW-00215_6
GGGTTTCGGGGCGCAGCCCTGAACCAGTCACATAGCGCTAGCGGAGTGTATACTGGCTTA
GGGTTTCGGGGCGCAGCCCTGAACCAGTCACATAGCGCTAGCGGAGTGTATACTGGCTTA
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure fileHost bacterium
ID | 2206 | GenBank | NZ_JABXQS010000006 |
Plasmid name | pRHBSTW-00215_6 | Incompatibility group | Col440II |
Plasmid size | 7931 bp | Coordinate of oriT [Strand] | 2933..2992 [+] |
Host baterium | Klebsiella sp. RHBSTW-00215 |
Cargo genes
Drug resistance gene | - |
Virulence gene | - |
Metal resistance gene | - |
Degradation gene | - |
Symbiosis gene | - |
Anti-CRISPR | - |