Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 101753 |
| Name | oriT_pRHBSTW-00209_9  |
| Organism | Enterobacter asburiae strain RHBSTW-00209 |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | NZ_JABXQT010000009 (1011..1069 [+], 59 nt) |
| oriT length | 59 nt |
| IRs (inverted repeats) | _ |
| Location of nic site | _ |
| Conserved sequence flanking the nic site |
_ |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 59 nt
>oriT_pRHBSTW-00209_9
GGGTTCCGGGCGCAGCGCCGGACCAGTCACGTAGCGCTAGCGGAGTGTATACTGGCTTA
GGGTTCCGGGCGCAGCGCCGGACCAGTCACGTAGCGCTAGCGGAGTGTATACTGGCTTA
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
Host bacterium
| ID | 2197 | GenBank | NZ_JABXQT010000009 |
| Plasmid name | pRHBSTW-00209_9 | Incompatibility group | - |
| Plasmid size | 1443 bp | Coordinate of oriT [Strand] | 1011..1069 [+] |
| Host baterium | Enterobacter asburiae strain RHBSTW-00209 |
Cargo genes
| Drug resistance gene | - |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |