Detailed information of oriT

oriT


The information of the oriT region


oriTDB ID   101746
Name   oriT_pRHBSTW-00189_12 in_silico
Organism   Klebsiella grimontii strain RHBSTW-00189
Sequence Completeness      -
NCBI accession of oriT (coordinates [strand])   NZ_JABXQY010000012 (2171..2348 [-], 178 nt)
oriT length   178 nt
IRs (inverted repeats)      100..105, 110..115  (ACCCCC..GGGGGT)
Location of nic site      _
Conserved sequence flanking the
  nic site  
 
 _
Note   Predicted by oriTfinder 2.0

  oriT sequence  


Download         Length: 178 nt

>oriT_pRHBSTW-00189_12
GGTTATAACAGTACTATAAGTAGTTGTTTCAACCCGTCTTTTTGGGTGGAACAACAAGGCATTTTAGGGATAGAGCAAAGCGAAGGCCATAAAATTGCCACCCCCAACCGGGGGTCGTTGTTCGATTTGAGCGATAGCGAAAAATTGAACATAAGGGGGGAGGGTTTGGGTTTTACGG

Visualization of oriT structure

  oriT secondary structure

Predicted by RNAfold.

Download structure file


Host bacterium


ID   2190 GenBank   NZ_JABXQY010000012
Plasmid name   pRHBSTW-00189_12 Incompatibility group   Col
Plasmid size   2348 bp Coordinate of oriT [Strand]   2171..2348 [-]
Host baterium   Klebsiella grimontii strain RHBSTW-00189

Cargo genes


Drug resistance gene   -
Virulence gene   -
Metal resistance gene   -
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   -