Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 101741 |
| Name | oriT_pRHBSTW-00109_6  |
| Organism | Klebsiella michiganensis strain RHBSTW-00109 |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | NZ_JABXRJ010000006 (3963..4012 [-], 50 nt) |
| oriT length | 50 nt |
| IRs (inverted repeats) | 6..12, 15..21 (CAAAATT..AATTTTG) |
| Location of nic site | _ |
| Conserved sequence flanking the nic site |
_ |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 50 nt
>oriT_pRHBSTW-00109_6
ATCTTCAAAATTTTAATTTTGCGTGGGGTGTGGGTATTTTTAGTGGTGAG
ATCTTCAAAATTTTAATTTTGCGTGGGGTGTGGGTATTTTTAGTGGTGAG
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
Host bacterium
| ID | 2185 | GenBank | NZ_JABXRJ010000006 |
| Plasmid name | pRHBSTW-00109_6 | Incompatibility group | Col440I |
| Plasmid size | 4713 bp | Coordinate of oriT [Strand] | 3963..4012 [-] |
| Host baterium | Klebsiella michiganensis strain RHBSTW-00109 |
Cargo genes
| Drug resistance gene | - |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |