Detailed information of oriT

oriT


The information of the oriT region


oriTDB ID   101738
Name   oriT_pRHB03-C11_10 in_silico
Organism   Escherichia fergusonii strain RHB03-C11
Sequence Completeness      -
NCBI accession of oriT (coordinates [strand])   NZ_JABXVT010000010 (924..996 [+], 73 nt)
oriT length   73 nt
IRs (inverted repeats)     _
Location of nic site      _
Conserved sequence flanking the
  nic site  
 
 _
Note   Predicted by oriTfinder 2.0

  oriT sequence  


Download         Length: 73 nt

>oriT_pRHB03-C11_10
GTCGGGGTGAAGCCCTGACCAGGTGGTGAATGTCTGAGTGCGCGTGCGCGGTCCGACATTCCCACATCCTGTC

Visualization of oriT structure

  oriT secondary structure

Predicted by RNAfold.

Download structure file


Host bacterium


ID   2182 GenBank   NZ_JABXVT010000010
Plasmid name   pRHB03-C11_10 Incompatibility group   Col
Plasmid size   1902 bp Coordinate of oriT [Strand]   924..996 [+]
Host baterium   Escherichia fergusonii strain RHB03-C11

Cargo genes


Drug resistance gene   -
Virulence gene   -
Metal resistance gene   -
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   -