Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 101717 |
| Name | oriT_pRHBSTW-00131_6  |
| Organism | Enterobacter sp. RHBSTW-00131 |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | NZ_JABXRH010000006 (2734..2791 [-], 58 nt) |
| oriT length | 58 nt |
| IRs (inverted repeats) | _ |
| Location of nic site | _ |
| Conserved sequence flanking the nic site |
_ |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 58 nt
>oriT_pRHBSTW-00131_6
GGGTTTCGGGGCGCAGCCCTGAACCAGTCAAGTAGCACGTGCGGAGTGTATACGGGCT
GGGTTTCGGGGCGCAGCCCTGAACCAGTCAAGTAGCACGTGCGGAGTGTATACGGGCT
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
Host bacterium
| ID | 2161 | GenBank | NZ_JABXRH010000006 |
| Plasmid name | pRHBSTW-00131_6 | Incompatibility group | ColRNAI |
| Plasmid size | 5941 bp | Coordinate of oriT [Strand] | 2734..2791 [-] |
| Host baterium | Enterobacter sp. RHBSTW-00131 |
Cargo genes
| Drug resistance gene | - |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |