Detailed information of oriT

oriT


The information of the oriT region


oriTDB ID   101715
Name   oriT_pRHBSTW-01045_48 in_silico
Organism   Enterobacter roggenkampii strain RHBSTW-01045
Sequence Completeness      -
NCBI accession of oriT (coordinates [strand])   NZ_JABXOW010000048 (42..101 [+], 60 nt)
oriT length   60 nt
IRs (inverted repeats)     _
Location of nic site      _
Conserved sequence flanking the
  nic site  
 
 _
Note   Predicted by oriTfinder 2.0

  oriT sequence  


Download         Length: 60 nt

>oriT_pRHBSTW-01045_48
GGGTTTCGGGGCGCAGCCCTGAACCAGTCACGTAGCGCTAGCGGAGTGTATACTGGCTTA

Visualization of oriT structure

  oriT secondary structure

Predicted by RNAfold.

Download structure file


Host bacterium


ID   2159 GenBank   NZ_JABXOW010000048
Plasmid name   pRHBSTW-01045_48 Incompatibility group   ColRNAI
Plasmid size   4165 bp Coordinate of oriT [Strand]   42..101 [+]
Host baterium   Enterobacter roggenkampii strain RHBSTW-01045

Cargo genes


Drug resistance gene   -
Virulence gene   -
Metal resistance gene   -
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   -