Detailed information of oriT
oriT
The information of the oriT region
oriTDB ID | 101708 |
Name | oriT_pRHB32-C07_9 |
Organism | Escherichia fergusonii strain RHB32-C07 |
Sequence Completeness | - |
NCBI accession of oriT (coordinates [strand]) | NZ_JABXSW010000009 (1070..1162 [+], 93 nt) |
oriT length | 93 nt |
IRs (inverted repeats) | _ |
Location of nic site | _ |
Conserved sequence flanking the nic site |
_ |
Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 93 nt
>oriT_pRHB32-C07_9
GGGGTGTCGGGGCGAAGCCCTGACCAGATGGCAAACGGAATATCGTCGCGGGTGACGGTATTACATTTGCACATCCTGTCCCGATTTTTGGGG
GGGGTGTCGGGGCGAAGCCCTGACCAGATGGCAAACGGAATATCGTCGCGGGTGACGGTATTACATTTGCACATCCTGTCCCGATTTTTGGGG
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure fileHost bacterium
ID | 2152 | GenBank | NZ_JABXSW010000009 |
Plasmid name | pRHB32-C07_9 | Incompatibility group | Col |
Plasmid size | 1551 bp | Coordinate of oriT [Strand] | 1070..1162 [+] |
Host baterium | Escherichia fergusonii strain RHB32-C07 |
Cargo genes
Drug resistance gene | - |
Virulence gene | - |
Metal resistance gene | - |
Degradation gene | - |
Symbiosis gene | - |
Anti-CRISPR | - |