Detailed information of oriT
oriT
The information of the oriT region
oriTDB ID | 101702 |
Name | oriT_pRHBSTW-00340_8 |
Organism | Enterobacter sp. RHBSTW-00340 |
Sequence Completeness | - |
NCBI accession of oriT (coordinates [strand]) | NZ_JABXQE010000008 (26655..26748 [+], 94 nt) |
oriT length | 94 nt |
IRs (inverted repeats) | 73..78, 84..89 (AAAAAA..TTTTTT) 27..34, 37..44 (AGCGTGAT..ATCACGCT) 13..19, 31..37 (TAAATCA..TGATTTA) |
Location of nic site | 55..56 |
Conserved sequence flanking the nic site |
GGTGTATAGC |
Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 94 nt
>oriT_pRHBSTW-00340_8
TTTTTTTTCTTTTAAATCAGTGGTATAGCGTGATTTATCACGCTGCGTTAGGTGTATAGCAGGTTAAGGGATAAAAAATCATCTTTTTTGGTAG
TTTTTTTTCTTTTAAATCAGTGGTATAGCGTGATTTATCACGCTGCGTTAGGTGTATAGCAGGTTAAGGGATAAAAAATCATCTTTTTTGGTAG
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure fileHost bacterium
ID | 2146 | GenBank | NZ_JABXQE010000008 |
Plasmid name | pRHBSTW-00340_8 | Incompatibility group | IncR |
Plasmid size | 49783 bp | Coordinate of oriT [Strand] | 26655..26748 [+] |
Host baterium | Enterobacter sp. RHBSTW-00340 |
Cargo genes
Drug resistance gene | - |
Virulence gene | mrkD, mrkF, mrkA, mrkB, mrkC |
Metal resistance gene | - |
Degradation gene | - |
Symbiosis gene | - |
Anti-CRISPR | - |