Detailed information of oriT

oriT


The information of the oriT region


oriTDB ID   101702
Name   oriT_pRHBSTW-00340_8 in_silico
Organism   Enterobacter sp. RHBSTW-00340
Sequence Completeness      -
NCBI accession of oriT (coordinates [strand])   NZ_JABXQE010000008 (26655..26748 [+], 94 nt)
oriT length   94 nt
IRs (inverted repeats)      73..78, 84..89  (AAAAAA..TTTTTT)
 27..34, 37..44  (AGCGTGAT..ATCACGCT)
 13..19, 31..37  (TAAATCA..TGATTTA)
Location of nic site      55..56
Conserved sequence flanking the
  nic site  
 
 GGTGTATAGC
Note   Predicted by oriTfinder 2.0

  oriT sequence  


Download         Length: 94 nt

>oriT_pRHBSTW-00340_8
TTTTTTTTCTTTTAAATCAGTGGTATAGCGTGATTTATCACGCTGCGTTAGGTGTATAGCAGGTTAAGGGATAAAAAATCATCTTTTTTGGTAG

Visualization of oriT structure

  oriT secondary structure

Predicted by RNAfold.

Download structure file


Host bacterium


ID   2146 GenBank   NZ_JABXQE010000008
Plasmid name   pRHBSTW-00340_8 Incompatibility group   IncR
Plasmid size   49783 bp Coordinate of oriT [Strand]   26655..26748 [+]
Host baterium   Enterobacter sp. RHBSTW-00340

Cargo genes


Drug resistance gene   -
Virulence gene   mrkD, mrkF, mrkA, mrkB, mrkC
Metal resistance gene   -
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   -