Detailed information of oriT

oriT


The information of the oriT region


oriTDB ID   101700
Name   oriT_pRHBSTW-00318_2 in_silico
Organism   Enterobacter sp. RHBSTW-00318
Sequence Completeness      -
NCBI accession of oriT (coordinates [strand])   NZ_JABXQH010000002 (26655..26748 [+], 94 nt)
oriT length   94 nt
IRs (inverted repeats)      73..78, 84..89  (AAAAAA..TTTTTT)
 27..34, 37..44  (AGCGTGAT..ATCACGCT)
 13..19, 31..37  (TAAATCA..TGATTTA)
Location of nic site      55..56
Conserved sequence flanking the
  nic site  
 
 GGTGTATAGC
Note   Predicted by oriTfinder 2.0

  oriT sequence  


Download         Length: 94 nt

>oriT_pRHBSTW-00318_2
TTTTTTTTCTTTTAAATCAGTGGTATAGCGTGATTTATCACGCTGCGTTAGGTGTATAGCAGGTTAAGGGATAAAAAATCATCTTTTTTGGTAG

Visualization of oriT structure

  oriT secondary structure

Predicted by RNAfold.

Download structure file


Host bacterium


ID   2144 GenBank   NZ_JABXQH010000002
Plasmid name   pRHBSTW-00318_2 Incompatibility group   IncR
Plasmid size   49783 bp Coordinate of oriT [Strand]   26655..26748 [+]
Host baterium   Enterobacter sp. RHBSTW-00318

Cargo genes


Drug resistance gene   -
Virulence gene   mrkD, mrkF, mrkA, mrkB, mrkC
Metal resistance gene   -
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   -