Detailed information of oriT

oriT


The information of the oriT region


oriTDB ID   101696
Name   oriT_pRHBSTW-00757_46 in_silico
Organism   Enterobacter hormaechei strain RHBSTW-00757
Sequence Completeness      -
NCBI accession of oriT (coordinates [strand])   NZ_JABXPO010000046 (4343..4401 [-], 59 nt)
oriT length   59 nt
IRs (inverted repeats)     _
Location of nic site      _
Conserved sequence flanking the
  nic site  
 
 _
Note   Predicted by oriTfinder 2.0

  oriT sequence  


Download         Length: 59 nt

>oriT_pRHBSTW-00757_46
GGGTTTCGGGGTGCAGCCCTGAACCAGTCACGAGCGCTAGCGGAGTGTATACTGGCTTA

Visualization of oriT structure

  oriT secondary structure

Predicted by RNAfold.

Download structure file


Host bacterium


ID   2140 GenBank   NZ_JABXPO010000046
Plasmid name   pRHBSTW-00757_46 Incompatibility group   ColRNAI
Plasmid size   4666 bp Coordinate of oriT [Strand]   4343..4401 [-]
Host baterium   Enterobacter hormaechei strain RHBSTW-00757

Cargo genes


Drug resistance gene   -
Virulence gene   -
Metal resistance gene   -
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   -