Detailed information of oriT

oriT

The information of the oriT region

• oriTDB ID: 101691
• Name: oriT_EPA336|unnamed
• Organism: Escherichia coli strain EPA336
• Sequence Completeness: -
• NCBI accession of oriT (coordinates [strand]): NZ_SJTB01000019 (6994..7053 [+], 60 nt)
• oriT length: 60 nt
• IRs (inverted repeats): _
• Location of nic site: _
• Conserved sequence flanking the nic site: _
• Note: Predicted by oriTfinder 2.0

oriT sequence

• Length: 60 nt

>oriT_EPA336|unnamed
GGGTTTCGGGGCGCAGCCCTGAACCAGTCATGTAGCGCTAGCGGAGTGTATACTGGCTTA

oriT secondary structure

Predicted by RNAfold.

Host bacterium

• ID: 2135
• GenBank: NZ_SJTB01000019
• Plasmid name: EPA336|unnamed
• Incompatibility group: ColRNAI
• Plasmid size: 8379 bp
• Coordinate of oriT [Strand]: 6994..7053 [+]
• Host baterium: Escherichia coli strain EPA336

Cargo genes

• Drug resistance gene: aph(3'')-Ib, aph(6)-Id, tet(A)
• Virulence gene: -
• Metal resistance gene: -
• Degradation gene: -
• Symbiosis gene: -
• Anti-CRISPR: -