Detailed information of oriT

oriT


The information of the oriT region


oriTDB ID   101653
Name   oriT_unknown 3 in_silico
Organism   Yersinia pestis strain Yp2126
Sequence Completeness      -
NCBI accession of oriT (coordinates [strand])   NZ_LIXY01000019 (3208..3267 [+], 60 nt)
oriT length   60 nt
IRs (inverted repeats)     _
Location of nic site      _
Conserved sequence flanking the
  nic site  
 
 _
Note   Predicted by oriTfinder 2.0

  oriT sequence  


Download         Length: 60 nt

>oriT_unknown 3
GGGTGTCGGGGCGCAGCCATGACCCAGTCACGTAGCGATAGCGGAGTGTATACTGGCTTA

Visualization of oriT structure

  oriT secondary structure

Predicted by RNAfold.

Download structure file


Host bacterium


ID   2097 GenBank   NZ_LIXY01000019
Plasmid name   unknown 3 Incompatibility group   ColRNAI
Plasmid size   9614 bp Coordinate of oriT [Strand]   3208..3267 [+]
Host baterium   Yersinia pestis strain Yp2126

Cargo genes


Drug resistance gene   -
Virulence gene   pla
Metal resistance gene   -
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   -