Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 101650 |
| Name | oriT_pE9211p3  |
| Organism | Escherichia coli O104:H4 str. E92/11 |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | NZ_AHAU01000167 (333..432 [+], 100 nt) |
| oriT length | 100 nt |
| IRs (inverted repeats) | _ |
| Location of nic site | _ |
| Conserved sequence flanking the nic site |
_ |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 100 nt
>oriT_pE9211p3
CGGGGTGTCGGGGTGAAGCCCTGACCAAGTGGTAATCGTATCGGCGTGCATGCGCGGTTATACGATTACACATCCTGTCCCGATTTCTGAGGCGTTTTAA
CGGGGTGTCGGGGTGAAGCCCTGACCAAGTGGTAATCGTATCGGCGTGCATGCGCGGTTATACGATTACACATCCTGTCCCGATTTCTGAGGCGTTTTAA
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
Host bacterium
| ID | 2094 | GenBank | NZ_AHAU01000167 |
| Plasmid name | pE9211p3 | Incompatibility group | Col |
| Plasmid size | 1549 bp | Coordinate of oriT [Strand] | 333..432 [+] |
| Host baterium | Escherichia coli O104:H4 str. E92/11 |
Cargo genes
| Drug resistance gene | - |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |