Detailed information of oriT

oriT


The information of the oriT region


oriTDB ID   101650
Name   oriT_pE9211p3 in_silico
Organism   Escherichia coli O104:H4 str. E92/11
Sequence Completeness      -
NCBI accession of oriT (coordinates [strand])   NZ_AHAU01000167 (333..432 [+], 100 nt)
oriT length   100 nt
IRs (inverted repeats)     _
Location of nic site      _
Conserved sequence flanking the
  nic site  
 
 _
Note   Predicted by oriTfinder 2.0

  oriT sequence  


Download         Length: 100 nt

>oriT_pE9211p3
CGGGGTGTCGGGGTGAAGCCCTGACCAAGTGGTAATCGTATCGGCGTGCATGCGCGGTTATACGATTACACATCCTGTCCCGATTTCTGAGGCGTTTTAA

Visualization of oriT structure

  oriT secondary structure

Predicted by RNAfold.

Download structure file


Host bacterium


ID   2094 GenBank   NZ_AHAU01000167
Plasmid name   pE9211p3 Incompatibility group   Col
Plasmid size   1549 bp Coordinate of oriT [Strand]   333..432 [+]
Host baterium   Escherichia coli O104:H4 str. E92/11

Cargo genes


Drug resistance gene   -
Virulence gene   -
Metal resistance gene   -
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   -