Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 101641 |
| Name | oriT_KPN_KPC_HUG_09|p2  |
| Organism | Klebsiella pneumoniae strain KPN_KPC_HUG_09 |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | NZ_MUMN01000082 (659..708 [-], 50 nt) |
| oriT length | 50 nt |
| IRs (inverted repeats) | 7..14, 17..24 (GCAAAATT..AATTTTGC) |
| Location of nic site | 33..34 |
| Conserved sequence flanking the nic site |
GGTGTGGTGA |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 50 nt
>oriT_KPN_KPC_HUG_09|p2
AAATCTGCAAAATTTTAATTTTGCGTGGGGTGTGGTGATTTTGTGGTGAG
AAATCTGCAAAATTTTAATTTTGCGTGGGGTGTGGTGATTTTGTGGTGAG
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
T4SS
T4SS were predicted by using oriTfinder2.
Region 1: 101..20452
| Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
|---|---|---|---|---|---|---|
| B0W84_RS31060 (B0W84_30050) | 1..68 | + | 68 | Protein_0 | hypothetical protein | - |
| B0W84_RS28765 (B0W84_30055) | 101..586 | - | 486 | WP_001568108 | transglycosylase SLT domain-containing protein | virB1 |
| B0W84_RS28770 (B0W84_30060) | 1008..1406 | + | 399 | WP_004152493 | conjugal transfer relaxosome DNA-binding protein TraM | - |
| B0W84_RS28775 (B0W84_30065) | 1580..2266 | + | 687 | WP_004152494 | transcriptional regulator TraJ family protein | - |
| B0W84_RS28780 (B0W84_30070) | 2345..2731 | + | 387 | WP_004152495 | TraY domain-containing protein | - |
| B0W84_RS28785 (B0W84_30075) | 2785..3153 | + | 369 | WP_004152496 | type IV conjugative transfer system pilin TraA | - |
| B0W84_RS28790 (B0W84_30080) | 3167..3472 | + | 306 | WP_004144424 | type IV conjugative transfer system protein TraL | traL |
| B0W84_RS28795 (B0W84_30085) | 3492..4058 | + | 567 | WP_004144423 | type IV conjugative transfer system protein TraE | traE |
| B0W84_RS28800 (B0W84_30090) | 4045..4785 | + | 741 | WP_004152497 | type-F conjugative transfer system secretin TraK | traK |
| B0W84_RS28805 (B0W84_30095) | 4785..6209 | + | 1425 | WP_004155033 | F-type conjugal transfer pilus assembly protein TraB | traB |
| B0W84_RS28810 (B0W84_30100) | 6323..6907 | + | 585 | WP_004161368 | type IV conjugative transfer system lipoprotein TraV | traV |
| B0W84_RS28815 (B0W84_30105) | 7039..7449 | + | 411 | WP_004152499 | hypothetical protein | - |
| B0W84_RS28820 (B0W84_30110) | 7555..7773 | + | 219 | WP_004152501 | hypothetical protein | - |
| B0W84_RS28825 (B0W84_30115) | 7774..8085 | + | 312 | WP_004152502 | hypothetical protein | - |
| B0W84_RS28830 (B0W84_30120) | 8152..8556 | + | 405 | WP_004152503 | hypothetical protein | - |
| B0W84_RS28835 (B0W84_30125) | 8599..8988 | + | 390 | WP_004153076 | hypothetical protein | - |
| B0W84_RS28840 (B0W84_30130) | 8996..9394 | + | 399 | WP_011977783 | hypothetical protein | - |
| B0W84_RS28845 (B0W84_30135) | 9466..12105 | + | 2640 | WP_004152505 | type IV secretion system protein TraC | virb4 |
| B0W84_RS28850 (B0W84_30140) | 12105..12494 | + | 390 | WP_004152506 | type-F conjugative transfer system protein TrbI | - |
| B0W84_RS28855 (B0W84_30145) | 12494..13120 | + | 627 | WP_004152507 | type-F conjugative transfer system protein TraW | traW |
| B0W84_RS28860 (B0W84_30150) | 13162..13551 | + | 390 | WP_004152508 | hypothetical protein | - |
| B0W84_RS28865 (B0W84_30155) | 13548..14537 | + | 990 | WP_011977785 | conjugal transfer pilus assembly protein TraU | traU |
| B0W84_RS28870 (B0W84_30160) | 14550..15188 | + | 639 | WP_004152672 | type-F conjugative transfer system pilin assembly protein TrbC | trbC |
| B0W84_RS28875 (B0W84_30165) | 15247..17202 | + | 1956 | WP_004152673 | type-F conjugative transfer system mating-pair stabilization protein TraN | traN |
| B0W84_RS28880 (B0W84_30170) | 17234..17488 | + | 255 | WP_004152674 | conjugal transfer protein TrbE | - |
| B0W84_RS28885 (B0W84_30175) | 17466..17714 | + | 249 | WP_004152675 | hypothetical protein | - |
| B0W84_RS28890 (B0W84_30180) | 17727..18053 | + | 327 | WP_004152676 | hypothetical protein | - |
| B0W84_RS28895 (B0W84_30185) | 18074..18826 | + | 753 | WP_004152677 | type-F conjugative transfer system pilin assembly protein TraF | traF |
| B0W84_RS28900 (B0W84_30190) | 18837..19076 | + | 240 | WP_004144400 | type-F conjugative transfer system pilin chaperone TraQ | - |
| B0W84_RS28905 (B0W84_30195) | 19048..19605 | + | 558 | WP_004152678 | type-F conjugative transfer system pilin assembly thiol-disulfide isomerase TrbB | traF |
| B0W84_RS28910 (B0W84_30200) | 19651..20094 | + | 444 | WP_004152679 | F-type conjugal transfer protein TrbF | - |
| B0W84_RS28915 (B0W84_30205) | 20072..20452 | + | 381 | WP_173669665 | conjugal transfer protein TraH | traH |
Host bacterium
| ID | 2085 | GenBank | NZ_MUMN01000082 |
| Plasmid name | KPN_KPC_HUG_09|p2 | Incompatibility group | - |
| Plasmid size | 20452 bp | Coordinate of oriT [Strand] | 659..708 [-] |
| Host baterium | Klebsiella pneumoniae strain KPN_KPC_HUG_09 |
Cargo genes
| Drug resistance gene | - |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |