Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 101636 |
| Name | oriT_CP2|p1  |
| Organism | Clostridium perfringens strain CP2 |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | NZ_JAMWML010000153 (890..1039 [-], 150 nt) |
| oriT length | 150 nt |
| IRs (inverted repeats) | 133..138, 142..147 (ATACAT..ATGTAT) 117..123, 137..143 (ATTATAT..ATATAAT) 119..125, 129..135 (TATATAT..ATATATA) 121..127, 129..135 (TATATAT..ATATATA) 123..128, 130..135 (TATATA..TATATA) 112..118, 122..128 (TATATAT..ATATATA) 112..118, 120..126 (TATATAT..ATATATA) 112..117, 119..124 (TATATA..TATATA) 20..25, 28..33 (TTTAAA..TTTAAA) |
| Location of nic site | _ |
| Conserved sequence flanking the nic site |
_ |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 150 nt
>oriT_CP2|p1
AAGGAACTTTACAGGGAACTTTAAAAATTTAAATTGATATAAAAGTTCCCTGTATAAATATAAGTATTTTAAAGGCATATATCATTATTAGTTCCTTATCGTATTATAGAGTATATATTATATATATAATATATACATATAATGTATTGG
AAGGAACTTTACAGGGAACTTTAAAAATTTAAATTGATATAAAAGTTCCCTGTATAAATATAAGTATTTTAAAGGCATATATCATTATTAGTTCCTTATCGTATTATAGAGTATATATTATATATATAATATATACATATAATGTATTGG
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
Host bacterium
| ID | 2080 | GenBank | NZ_JAMWML010000153 |
| Plasmid name | CP2|p1 | Incompatibility group | - |
| Plasmid size | 1074 bp | Coordinate of oriT [Strand] | 890..1039 [-] |
| Host baterium | Clostridium perfringens strain CP2 |
Cargo genes
| Drug resistance gene | - |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |