Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 101629 |
| Name | oriT_aEPEC 3991-1/90|unnamed3  |
| Organism | Escherichia coli strain aEPEC 3991-1/90 |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | NZ_JAXUFV010000131 (108..180 [+], 73 nt) |
| oriT length | 73 nt |
| IRs (inverted repeats) | _ |
| Location of nic site | _ |
| Conserved sequence flanking the nic site |
_ |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 73 nt
>oriT_aEPEC 3991-1/90|unnamed3
GTCGGGGTGAAGCCCTGACCAAGTGGGGAATGTCTGAGTGCGCGTGCGCGGTCCGACATTCCCACATCCTGTC
GTCGGGGTGAAGCCCTGACCAAGTGGGGAATGTCTGAGTGCGCGTGCGCGGTCCGACATTCCCACATCCTGTC
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
Host bacterium
| ID | 2073 | GenBank | NZ_JAXUFV010000131 |
| Plasmid name | aEPEC 3991-1/90|unnamed3 | Incompatibility group | Col |
| Plasmid size | 1780 bp | Coordinate of oriT [Strand] | 108..180 [+] |
| Host baterium | Escherichia coli strain aEPEC 3991-1/90 |
Cargo genes
| Drug resistance gene | - |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |