Detailed information of oriT

oriT


The information of the oriT region


oriTDB ID   101627
Name   oriT1_aEPEC 3391-3/89|unnamed4 in_silico
Organism   Escherichia coli strain aEPEC 3391-3/89
Sequence Completeness      -
NCBI accession of oriT (coordinates [strand])   NZ_JAXUFW010000127 (62..134 [+], 73 nt)
oriT length   73 nt
IRs (inverted repeats)     _
Location of nic site      _
Conserved sequence flanking the
  nic site  
 
 _
Note   Predicted by oriTfinder 2.0

  oriT sequence  


Download         Length: 73 nt

>oriT1_aEPEC 3391-3/89|unnamed4
GTCGGGGTGAAGCCCTGACCAGGTGGGGAATGTCTGAGTGCGCGTGCGCGGTCCGACATTCCCACATCCTGTC

Visualization of oriT structure

  oriT secondary structure

Predicted by RNAfold.

Download structure file


Host bacterium


ID   2071 GenBank   NZ_JAXUFW010000127
Plasmid name   aEPEC 3391-3/89|unnamed4 Incompatibility group   Col
Plasmid size   1673 bp Coordinate of oriT [Strand]   62..134 [+]; 1608..1673 [+]
Host baterium   Escherichia coli strain aEPEC 3391-3/89

Cargo genes


Drug resistance gene   -
Virulence gene   -
Metal resistance gene   -
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   -