Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 101623 |
| Name | oriT_p1S-10  |
| Organism | Escherichia sp. S10b |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | NZ_JAHZSO010000001 (2426..2500 [+], 75 nt) |
| oriT length | 75 nt |
| IRs (inverted repeats) | _ |
| Location of nic site | _ |
| Conserved sequence flanking the nic site |
_ |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 75 nt
>oriT_p1S-10
GTCGGGGCGAAGCCCTGACCAGGGTAATTGTAATAGCGTGCATGTATGCGCGGTATAACAATTGCACATCCTGTC
GTCGGGGCGAAGCCCTGACCAGGGTAATTGTAATAGCGTGCATGTATGCGCGGTATAACAATTGCACATCCTGTC
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
Host bacterium
| ID | 2067 | GenBank | NZ_JAHZSO010000001 |
| Plasmid name | p1S-10 | Incompatibility group | ColRNAI |
| Plasmid size | 3264 bp | Coordinate of oriT [Strand] | 2426..2500 [+] |
| Host baterium | Escherichia sp. S10b |
Cargo genes
| Drug resistance gene | - |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |