Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 101595 |
| Name | oriT_pCol_IRGK  |
| Organism | Escherichia coli strain C7S7_NCKT7 |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | NZ_JAJPGP010000159 (1080..1263 [-], 184 nt) |
| oriT length | 184 nt |
| IRs (inverted repeats) | 106..111, 116..121 (ACCCCC..GGGGGT) |
| Location of nic site | _ |
| Conserved sequence flanking the nic site |
_ |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 184 nt
>oriT_pCol_IRGK
CCACCCGGATATAACAGTAGTATAAGTTGTTGTTTCAACCCGTCTTTTTGGGTGGAACAACAAGGCATTTTAGGGATAGAGCAAAGCGAAGGCCATAAAATTGCCACCCCCAACCGGGGGTCGTTGTTCGATTTGAGCGATAGCGAAAAATTGAACATAAGGGGGGAGGGTTTGGGTTTTACGG
CCACCCGGATATAACAGTAGTATAAGTTGTTGTTTCAACCCGTCTTTTTGGGTGGAACAACAAGGCATTTTAGGGATAGAGCAAAGCGAAGGCCATAAAATTGCCACCCCCAACCGGGGGTCGTTGTTCGATTTGAGCGATAGCGAAAAATTGAACATAAGGGGGGAGGGTTTGGGTTTTACGG
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
Host bacterium
| ID | 2039 | GenBank | NZ_JAJPGP010000159 |
| Plasmid name | pCol_IRGK | Incompatibility group | Col |
| Plasmid size | 2492 bp | Coordinate of oriT [Strand] | 1080..1263 [-] |
| Host baterium | Escherichia coli strain C7S7_NCKT7 |
Cargo genes
| Drug resistance gene | - |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |