Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 101563 |
| Name | oriT_B7S79|unnamed3  |
| Organism | Escherichia coli strain B7S79 |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | NZ_SJSV01000086 (2347..2421 [+], 75 nt) |
| oriT length | 75 nt |
| IRs (inverted repeats) | _ |
| Location of nic site | _ |
| Conserved sequence flanking the nic site |
_ |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 75 nt
>oriT_B7S79|unnamed3
GTCGGGGCGAAGCCCTGACCAGGGTAATTGTAATAGCGTGCATGTATGCGCGGTATAACAATTGCACATCCTGTC
GTCGGGGCGAAGCCCTGACCAGGGTAATTGTAATAGCGTGCATGTATGCGCGGTATAACAATTGCACATCCTGTC
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
Host bacterium
| ID | 2007 | GenBank | NZ_SJSV01000086 |
| Plasmid name | B7S79|unnamed3 | Incompatibility group | Col440I |
| Plasmid size | 3088 bp | Coordinate of oriT [Strand] | 2347..2421 [+] |
| Host baterium | Escherichia coli strain B7S79 |
Cargo genes
| Drug resistance gene | - |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |