Detailed information of oriT

oriT


The information of the oriT region


oriTDB ID   101545
Name   oriT1_B7S79|unnamed5 in_silico
Organism   Escherichia coli strain B7S79
Sequence Completeness      -
NCBI accession of oriT (coordinates [strand])   NZ_SJSV01000074 (4174..4260 [-], 87 nt)
oriT length   87 nt
IRs (inverted repeats)     _
Location of nic site      _
Conserved sequence flanking the
  nic site  
 
 _
Note   Predicted by oriTfinder 2.0

  oriT sequence  


Download         Length: 87 nt

>oriT1_B7S79|unnamed5
GGGGTGTCGGGGTGAAGCCCTGACCAGATGGCAAACGGAATATCGTCGCGGGTGACGGTATTACATTTGCACATCCTGTCCCGATTT

Visualization of oriT structure

  oriT secondary structure

Predicted by RNAfold.

Download structure file


Host bacterium


ID   1989 GenBank   NZ_SJSV01000074
Plasmid name   B7S79|unnamed5 Incompatibility group   Col
Plasmid size   4361 bp Coordinate of oriT [Strand]   4174..4260 [-]; 2671..2756 [-]
Host baterium   Escherichia coli strain B7S79

Cargo genes


Drug resistance gene   -
Virulence gene   -
Metal resistance gene   -
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   -