Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 101532 |
| Name | oriT_FWSEC0426|unnamed2  |
| Organism | Escherichia coli strain FWSEC0426 |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | NZ_RROV01000171 (1176..1299 [+], 124 nt) |
| oriT length | 124 nt |
| IRs (inverted repeats) | 92..99, 113..120 (ATAATGTA..TACATTAT) 90..95, 107..112 (AAATAA..TTATTT) 39..46, 49..56 (GCAAAAAC..GTTTTTGC) 3..10, 15..22 (TTGGTGGT..ACCACCAA) |
| Location of nic site | _ |
| Conserved sequence flanking the nic site |
_ |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 124 nt
>oriT_FWSEC0426|unnamed2
GGTTGGTGGTTCTCACCACCAAAAGCACCACACCCCACGCAAAAACAAGTTTTTGCTGATTTGATATTTGAATCATTAACTTATGTTTTAAATAATGTATTTTAATTTATTTTACATTATAAAA
GGTTGGTGGTTCTCACCACCAAAAGCACCACACCCCACGCAAAAACAAGTTTTTGCTGATTTGATATTTGAATCATTAACTTATGTTTTAAATAATGTATTTTAATTTATTTTACATTATAAAA
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
T4SS
T4SS were predicted by using oriTfinder2.
Region 1: 604..7446
| Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
|---|---|---|---|---|---|---|
| C9201_RS28100 (C9201_28125) | 1..308 | + | 308 | WP_169072998 | DUF932 domain-containing protein | - |
| C9201_RS28105 (C9201_28130) | 604..1113 | - | 510 | WP_001477373 | transglycosylase SLT domain-containing protein | virB1 |
| C9201_RS28110 (C9201_28135) | 1536..1922 | + | 387 | WP_042968749 | conjugal transfer relaxosome DNA-binding protein TraM | - |
| C9201_RS28115 (C9201_28140) | 2111..2800 | + | 690 | WP_042968747 | PAS domain-containing protein | - |
| C9201_RS28120 (C9201_28145) | 2888..3115 | + | 228 | WP_032142519 | conjugal transfer relaxosome protein TraY | - |
| C9201_RS28125 (C9201_28150) | 3150..3503 | + | 354 | WP_001098217 | type IV conjugative transfer system pilin TraA | - |
| C9201_RS28130 (C9201_28155) | 3518..3829 | + | 312 | WP_000012108 | type IV conjugative transfer system protein TraL | traL |
| C9201_RS28135 (C9201_28160) | 3851..4417 | + | 567 | WP_000399759 | type IV conjugative transfer system protein TraE | traE |
| C9201_RS28140 (C9201_28165) | 4404..5132 | + | 729 | WP_021573902 | type-F conjugative transfer system secretin TraK | traK |
| C9201_RS28145 (C9201_28170) | 5132..6562 | + | 1431 | WP_000146622 | F-type conjugal transfer pilus assembly protein TraB | traB |
| C9201_RS28150 (C9201_28175) | 6552..7139 | + | 588 | WP_000002896 | conjugal transfer pilus-stabilizing protein TraP | - |
| C9201_RS28155 (C9201_28180) | 7126..7446 | + | 321 | WP_001057265 | conjugal transfer protein TrbD | virb4 |
| C9201_RS28160 (C9201_28185) | 7439..7635 | + | 197 | WP_136759421 | conjugal transfer protein TrbG | - |
Host bacterium
| ID | 1976 | GenBank | NZ_RROV01000171 |
| Plasmid name | FWSEC0426|unnamed2 | Incompatibility group | - |
| Plasmid size | 7635 bp | Coordinate of oriT [Strand] | 1176..1299 [+] |
| Host baterium | Escherichia coli strain FWSEC0426 |
Cargo genes
| Drug resistance gene | - |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |