Detailed information of oriT

oriT


The information of the oriT region


oriTDB ID   101523
Name   oriT_S8|unnamed in_silico
Organism   Citrobacter freundii strain S8
Sequence Completeness      -
NCBI accession of oriT (coordinates [strand])   NZ_JARESH010000189 (2119..2178 [-], 60 nt)
oriT length   60 nt
IRs (inverted repeats)     _
Location of nic site      _
Conserved sequence flanking the
  nic site  
 
 _
Note   Predicted by oriTfinder 2.0

  oriT sequence  


Download         Length: 60 nt

>oriT_S8|unnamed
GGGTTTCGGGGCGCAGCCCTGAACCAGTCACAGTGCGCTAGCGCTGTGTATAATGGCTTA

Visualization of oriT structure

  oriT secondary structure

Predicted by RNAfold.

Download structure file


Host bacterium


ID   1967 GenBank   NZ_JARESH010000189
Plasmid name   S8|unnamed Incompatibility group   ColRNAI
Plasmid size   6575 bp Coordinate of oriT [Strand]   2119..2178 [-]
Host baterium   Citrobacter freundii strain S8

Cargo genes


Drug resistance gene   -
Virulence gene   -
Metal resistance gene   -
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   -