Detailed information of oriT

oriT


The information of the oriT region


oriTDB ID   101503
Name   oriT_FWSEC0426|unnamed2 in_silico
Organism   Escherichia coli strain FWSEC0426
Sequence Completeness      -
NCBI accession of oriT (coordinates [strand])   NZ_RROV01000159 (1730..2081 [+], 352 nt)
oriT length   352 nt
IRs (inverted repeats)      255..262, 271..278  (ACCGCTAG..CTAGCGGT)
 192..198, 206..212  (TATAAAA..TTTTATA)
 40..47, 50..57  (GCAAAAAC..GTTTTTGC)
 4..11, 16..23  (TTGGTGGT..ACCACCAA)
Location of nic site      _
Conserved sequence flanking the
  nic site  
 
 _
Note   Predicted by oriTfinder 2.0

  oriT sequence  


Download         Length: 352 nt

>oriT_FWSEC0426|unnamed2
AGGTTGGTGGTTCTCACCACCAAAAGCACCACACCCCACGCAAAAACAAGTTTTTGCTGATTTTTCTTTATAAATAGAGTGTTATGAAAAATTAGTTTCTCTTACTCTCTTTATGATATTTAAAAAAGCGGTGTCGGCGCGGCTACAACAACGCGCCGACACCGTTTTGTAGGGGTGGTACTGACTATTTTTATAAAAAACATTATTTTATATTAGGGGGGGCTGCTAGCGGCGCGGTGTGTTTTTTATAGGATACCGCTAGGGGCGCTGCTAGCGGTGCGTCCCTGTTTGCATTATGAATTTTAGTGTTTCGAAATTAACTTTATTTTATGTTCAAAAAAGGTAATCTCTA

Visualization of oriT structure

  oriT secondary structure

Predicted by RNAfold.

Download structure file


Host bacterium


ID   1947 GenBank   NZ_RROV01000159
Plasmid name   FWSEC0426|unnamed2 Incompatibility group   -
Plasmid size   8261 bp Coordinate of oriT [Strand]   1730..2081 [+]
Host baterium   Escherichia coli strain FWSEC0426

Cargo genes


Drug resistance gene   -
Virulence gene   -
Metal resistance gene   -
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   -