Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 101493 |
| Name | oriT1_p2560-4  |
| Organism | Escherichia coli strain GN02560 |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | NZ_JALJQO010000004 (2825..2910 [-], 86 nt) |
| oriT length | 86 nt |
| IRs (inverted repeats) | _ |
| Location of nic site | _ |
| Conserved sequence flanking the nic site |
_ |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 86 nt
>oriT1_p2560-4
GGGTGTCGGGGCGCAGCCCTGACCAGATGGCAATTGTGATAGCGTCGCGTGTGACGGTATTACAATTGCACATCCTGTCCCGATTT
GGGTGTCGGGGCGCAGCCCTGACCAGATGGCAATTGTGATAGCGTCGCGTGTGACGGTATTACAATTGCACATCCTGTCCCGATTT
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
Host bacterium
| ID | 1937 | GenBank | NZ_JALJQO010000004 |
| Plasmid name | p2560-4 | Incompatibility group | Col |
| Plasmid size | 4550 bp | Coordinate of oriT [Strand] | 2825..2910 [-]; 1322..1404 [-] |
| Host baterium | Escherichia coli strain GN02560 |
Cargo genes
| Drug resistance gene | - |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |