Detailed information of oriT

oriT


The information of the oriT region


oriTDB ID   101488
Name   oriT_MRSN 12115|unnamed in_silico
Organism   Citrobacter freundii strain MRSN 12115
Sequence Completeness      -
NCBI accession of oriT (coordinates [strand])   NZ_JYFZ02000006 (12994..13098 [+], 105 nt)
oriT length   105 nt
IRs (inverted repeats)      56..61, 74..79  (TGGAAT..ATTCCA)
 46..51, 56..61  (ATTCCA..TGGAAT)
 1..6, 8..13  (AATTTG..CAAATT)
Location of nic site      _
Conserved sequence flanking the
  nic site  
 
 _
Note   Predicted by oriTfinder 2.0

  oriT sequence  


Download         Length: 105 nt

>oriT_MRSN 12115|unnamed
AATTTGACAAATTCCAAAGATGGGTTAGCCTAGTGACAGAACTAGATTCCAGTATTGGAATAATCAGCTTTAAATTCCAGATAGATAGTTATGTGGATAGGAATT

Visualization of oriT structure

  oriT secondary structure

Predicted by RNAfold.

Download structure file


Host bacterium


ID   1932 GenBank   NZ_JYFZ02000006
Plasmid name   MRSN 12115|unnamed Incompatibility group   IncA/C2
Plasmid size   46341 bp Coordinate of oriT [Strand]   12994..13098 [+]
Host baterium   Citrobacter freundii strain MRSN 12115

Cargo genes


Drug resistance gene   -
Virulence gene   -
Metal resistance gene   -
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   -