Detailed information of oriT

oriT


The information of the oriT region


oriTDB ID   101476
Name   oriT_FDAARGOS_1336|unnamed13 in_silico
Organism   Klebsiella oxytoca strain FDAARGOS_1336
Sequence Completeness      -
NCBI accession of oriT (coordinates [strand])   NZ_JAFFQV010000007 (545..644 [+], 100 nt)
oriT length   100 nt
IRs (inverted repeats)     _
Location of nic site      _
Conserved sequence flanking the
  nic site  
 
 _
Note   Predicted by oriTfinder 2.0

  oriT sequence  


Download         Length: 100 nt

>oriT_FDAARGOS_1336|unnamed13
CGGGGTGTCGGGGTGAAGCCCTGACCAAGTGGTAATCGTATCGGCGTGCATGCGCGGTTATACGATTACACATCCTGTCCCGATTTCTGAGGCGTTTTAA

Visualization of oriT structure

  oriT secondary structure

Predicted by RNAfold.

Download structure file


Host bacterium


ID   1920 GenBank   NZ_JAFFQV010000007
Plasmid name   FDAARGOS_1336|unnamed13 Incompatibility group   Col
Plasmid size   1549 bp Coordinate of oriT [Strand]   545..644 [+]
Host baterium   Klebsiella oxytoca strain FDAARGOS_1336

Cargo genes


Drug resistance gene   -
Virulence gene   -
Metal resistance gene   -
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   -