Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 101454 |
| Name | oriT_pCRE17_3  |
| Organism | Klebsiella michiganensis strain S17_CRE17 |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | NZ_JAHBNO010000005 (35788..35836 [-], 49 nt) |
| oriT length | 49 nt |
| IRs (inverted repeats) | 6..13, 16..23 (GCAAAATT..AATTTTGC) |
| Location of nic site | 32..33 |
| Conserved sequence flanking the nic site |
TGTGTGGTGA |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 49 nt
>oriT_pCRE17_3
AATCTGCAAAATTTTAATTTTGCGTAGTGTGTGGTGATTTTGTGGTGAG
AATCTGCAAAATTTTAATTTTGCGTAGTGTGTGGTGATTTTGTGGTGAG
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
T4SS
T4SS were predicted by using oriTfinder2.
Region 1: 38257..60800
| Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
|---|---|---|---|---|---|---|
| KIN65_RS30995 (KIN65_30860) | 34293..34463 | - | 171 | WP_164876868 | hypothetical protein | - |
| KIN65_RS31000 (KIN65_30865) | 34656..35198 | + | 543 | WP_064343524 | antirestriction protein | - |
| KIN65_RS31005 (KIN65_30870) | 35221..35643 | - | 423 | WP_239605204 | transglycosylase SLT domain-containing protein | - |
| KIN65_RS31010 (KIN65_30875) | 36149..36541 | + | 393 | WP_032426796 | conjugal transfer relaxosome DNA-binding protein TraM | - |
| KIN65_RS31015 (KIN65_30880) | 36779..37471 | + | 693 | WP_032426795 | conjugal transfer protein TrbJ | - |
| KIN65_RS31020 (KIN65_30885) | 37647..37811 | + | 165 | WP_032426810 | TraY domain-containing protein | - |
| KIN65_RS31025 (KIN65_30890) | 37875..38243 | + | 369 | WP_032426794 | type IV conjugative transfer system pilin TraA | - |
| KIN65_RS31030 (KIN65_30895) | 38257..38562 | + | 306 | WP_004144424 | type IV conjugative transfer system protein TraL | traL |
| KIN65_RS31035 (KIN65_30900) | 38582..39148 | + | 567 | WP_004144423 | type IV conjugative transfer system protein TraE | traE |
| KIN65_RS31040 (KIN65_30905) | 39135..39875 | + | 741 | WP_268013948 | type-F conjugative transfer system secretin TraK | traK |
| KIN65_RS31045 (KIN65_30910) | 39875..41299 | + | 1425 | WP_032426793 | F-type conjugal transfer pilus assembly protein TraB | traB |
| KIN65_RS31050 (KIN65_30915) | 41413..41982 | + | 570 | WP_032426791 | type IV conjugative transfer system lipoprotein TraV | traV |
| KIN65_RS31055 | 42137..42535 | + | 399 | WP_241659260 | hypothetical protein | - |
| KIN65_RS31060 (KIN65_30925) | 42564..42854 | + | 291 | WP_032426790 | hypothetical protein | - |
| KIN65_RS31065 (KIN65_30930) | 42878..43096 | + | 219 | WP_004171484 | hypothetical protein | - |
| KIN65_RS31070 (KIN65_30935) | 43097..43414 | + | 318 | WP_015065629 | hypothetical protein | - |
| KIN65_RS31075 (KIN65_30940) | 43481..43885 | + | 405 | WP_023320104 | hypothetical protein | - |
| KIN65_RS31080 (KIN65_30945) | 43910..44308 | + | 399 | WP_015065631 | hypothetical protein | - |
| KIN65_RS31085 (KIN65_30950) | 44380..47019 | + | 2640 | WP_268014049 | type IV secretion system protein TraC | virb4 |
| KIN65_RS31090 (KIN65_30955) | 47019..47408 | + | 390 | WP_004197815 | type-F conjugative transfer system protein TrbI | - |
| KIN65_RS31095 (KIN65_30960) | 47408..48034 | + | 627 | WP_268014050 | type-F conjugative transfer system protein TraW | traW |
| KIN65_RS31100 (KIN65_30965) | 48054..49037 | + | 984 | WP_223176982 | conjugal transfer pilus assembly protein TraU | traU |
| KIN65_RS31105 (KIN65_30970) | 49052..49600 | + | 549 | WP_022631518 | hypothetical protein | - |
| KIN65_RS31110 (KIN65_30975) | 49575..50264 | - | 690 | WP_032427592 | hypothetical protein | - |
| KIN65_RS31115 (KIN65_30980) | 50321..50923 | + | 603 | WP_022631520 | hypothetical protein | - |
| KIN65_RS31120 (KIN65_30985) | 51068..51715 | + | 648 | WP_071049145 | type-F conjugative transfer system pilin assembly protein TrbC | trbC |
| KIN65_RS31125 (KIN65_30990) | 51774..53729 | + | 1956 | WP_268013953 | type-F conjugative transfer system mating-pair stabilization protein TraN | traN |
| KIN65_RS31130 (KIN65_30995) | 53761..54015 | + | 255 | WP_020804203 | conjugal transfer protein TrbE | - |
| KIN65_RS31135 (KIN65_31000) | 53993..54241 | + | 249 | WP_004152675 | hypothetical protein | - |
| KIN65_RS31140 (KIN65_31005) | 54254..54580 | + | 327 | WP_004144402 | hypothetical protein | - |
| KIN65_RS31145 (KIN65_31010) | 54601..55353 | + | 753 | WP_004152677 | type-F conjugative transfer system pilin assembly protein TraF | traF |
| KIN65_RS31150 (KIN65_31015) | 55364..55603 | + | 240 | WP_004144400 | type-F conjugative transfer system pilin chaperone TraQ | - |
| KIN65_RS31155 (KIN65_31020) | 55575..56132 | + | 558 | WP_004152678 | type-F conjugative transfer system pilin assembly thiol-disulfide isomerase TrbB | traF |
| KIN65_RS31160 (KIN65_31025) | 56178..56621 | + | 444 | WP_004194305 | F-type conjugal transfer protein TrbF | - |
| KIN65_RS31165 (KIN65_31030) | 56599..57978 | + | 1380 | WP_014343487 | conjugal transfer pilus assembly protein TraH | traH |
| KIN65_RS31170 (KIN65_31035) | 57978..60800 | + | 2823 | WP_268014054 | conjugal transfer mating-pair stabilization protein TraG | traG |
| KIN65_RS31175 (KIN65_31040) | 60824..61426 | + | 603 | WP_071604857 | hypothetical protein | - |
| KIN65_RS31180 (KIN65_31045) | 61679..61780 | + | 102 | WP_268014059 | traT complement resistance domain protein | - |
Host bacterium
| ID | 1898 | GenBank | NZ_JAHBNO010000005 |
| Plasmid name | pCRE17_3 | Incompatibility group | - |
| Plasmid size | 61780 bp | Coordinate of oriT [Strand] | 35788..35836 [-] |
| Host baterium | Klebsiella michiganensis strain S17_CRE17 |
Cargo genes
| Drug resistance gene | - |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |