Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 101449 |
| Name | oriT_pCRE29_5  |
| Organism | Klebsiella pneumoniae strain S28_CRE29 |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | NZ_JAHBNW010000059 (2858..2908 [-], 51 nt) |
| oriT length | 51 nt |
| IRs (inverted repeats) | 6..13, 16..23 (GCAAAATT..AATTTTGC) |
| Location of nic site | _ |
| Conserved sequence flanking the nic site |
_ |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 51 nt
>oriT_pCRE29_5
AATCTGCAAAATTTTAATTTTGCGTGGGGTGTGGGTATTTTTAGTGGTGAG
AATCTGCAAAATTTTAATTTTGCGTGGGGTGTGGGTATTTTTAGTGGTGAG
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
Host bacterium
| ID | 1893 | GenBank | NZ_JAHBNW010000059 |
| Plasmid name | pCRE29_5 | Incompatibility group | Col440I |
| Plasmid size | 2927 bp | Coordinate of oriT [Strand] | 2858..2908 [-] |
| Host baterium | Klebsiella pneumoniae strain S28_CRE29 |
Cargo genes
| Drug resistance gene | - |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |