Detailed information of oriT
oriT
The information of the oriT region
oriTDB ID | 101446 |
Name | oriT_FWSEC0021|unnamed5 |
Organism | Escherichia coli strain FWSEC0021 |
Sequence Completeness | - |
NCBI accession of oriT (coordinates [strand]) | NZ_RRCV01000196 (8741..8826 [-], 86 nt) |
oriT length | 86 nt |
IRs (inverted repeats) | 61..68, 73..80 (TTGGTGGT..ACCACCAA) 27..34, 37..44 (GCAAAAAC..GTTTTTGC) 8..14, 20..26 (TGATTTA..TAAATCA) |
Location of nic site | 53..54 |
Conserved sequence flanking the nic site |
TGTGTGGTGC |
Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 86 nt
>oriT_FWSEC0021|unnamed5
AATTACATGATTTAAAACGTAAATCAGCAAAAACTTGTTTTTGCGTAGTGTGTGGTGCTTTTGGTGGTGAGAACCACCAACCTGTT
AATTACATGATTTAAAACGTAAATCAGCAAAAACTTGTTTTTGCGTAGTGTGTGGTGCTTTTGGTGGTGAGAACCACCAACCTGTT
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure fileT4SS
T4SS were predicted by using oriTfinder2.
Region 1: 8173..15557
Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
---|---|---|---|---|---|---|
C9Y74_RS26175 (C9Y74_26195) | 3548..3778 | + | 231 | WP_000218642 | hypothetical protein | - |
C9Y74_RS26180 (C9Y74_26200) | 3830..5191 | + | 1362 | WP_000170695 | DUF3560 domain-containing protein | - |
C9Y74_RS26185 (C9Y74_26205) | 5238..5801 | + | 564 | WP_001298559 | class I SAM-dependent methyltransferase | - |
C9Y74_RS26195 (C9Y74_26215) | 5887..6348 | - | 462 | Protein_11 | hypothetical protein | - |
C9Y74_RS26205 (C9Y74_26225) | 6648..6944 | + | 297 | WP_001272251 | hypothetical protein | - |
C9Y74_RS26210 (C9Y74_26230) | 7055..7876 | + | 822 | WP_001234445 | DUF932 domain-containing protein | - |
C9Y74_RS26215 (C9Y74_26235) | 8173..8775 | - | 603 | WP_000243713 | transglycosylase SLT domain-containing protein | virB1 |
C9Y74_RS26225 (C9Y74_26245) | 9098..9481 | + | 384 | WP_001354030 | conjugal transfer relaxosome DNA-binding protein TraM | - |
C9Y74_RS26230 (C9Y74_26250) | 9675..10346 | + | 672 | WP_000283561 | conjugal transfer transcriptional regulator TraJ | - |
C9Y74_RS26235 (C9Y74_26255) | 10483..10710 | + | 228 | WP_000089263 | conjugal transfer relaxosome protein TraY | - |
C9Y74_RS26240 (C9Y74_26260) | 10743..11102 | + | 360 | WP_001098992 | type IV conjugative transfer system pilin TraA | - |
C9Y74_RS26245 (C9Y74_26265) | 11117..11428 | + | 312 | WP_000012113 | type IV conjugative transfer system protein TraL | traL |
C9Y74_RS26250 (C9Y74_26270) | 11450..12016 | + | 567 | WP_000399780 | type IV conjugative transfer system protein TraE | traE |
C9Y74_RS26255 (C9Y74_26275) | 12003..12731 | + | 729 | WP_001230772 | type-F conjugative transfer system secretin TraK | traK |
C9Y74_RS26260 (C9Y74_26280) | 12731..14182 | + | 1452 | WP_000146675 | F-type conjugal transfer pilus assembly protein TraB | traB |
C9Y74_RS26265 (C9Y74_26285) | 14172..14738 | + | 567 | WP_000896599 | conjugal transfer pilus-stabilizing protein TraP | - |
C9Y74_RS26270 (C9Y74_26290) | 14725..15045 | + | 321 | WP_001057307 | conjugal transfer protein TrbD | - |
C9Y74_RS26275 (C9Y74_26295) | 15042..15557 | + | 516 | WP_000809881 | type IV conjugative transfer system lipoprotein TraV | traV |
C9Y74_RS26280 (C9Y74_26300) | 15692..15913 | + | 222 | WP_001278683 | conjugal transfer protein TraR | - |
C9Y74_RS26285 (C9Y74_26305) | 15906..16294 | + | 389 | WP_021527928 | hypothetical protein | - |
Host bacterium
ID | 1890 | GenBank | NZ_RRCV01000196 |
Plasmid name | FWSEC0021|unnamed5 | Incompatibility group | - |
Plasmid size | 16294 bp | Coordinate of oriT [Strand] | 8741..8826 [-] |
Host baterium | Escherichia coli strain FWSEC0021 |
Cargo genes
Drug resistance gene | - |
Virulence gene | - |
Metal resistance gene | - |
Degradation gene | - |
Symbiosis gene | - |
Anti-CRISPR | - |