Detailed information of oriT

oriT


The information of the oriT region


oriTDB ID   101442
Name   oriT_pCRE11_5 in_silico
Organism   Klebsiella variicola strain S11_CRE11
Sequence Completeness      -
NCBI accession of oriT (coordinates [strand])   NZ_JAHBNM010000007 (845..904 [-], 60 nt)
oriT length   60 nt
IRs (inverted repeats)     _
Location of nic site      _
Conserved sequence flanking the
  nic site  
 
 _
Note   Predicted by oriTfinder 2.0

  oriT sequence  


Download         Length: 60 nt

>oriT_pCRE11_5
GGGTTTCGGGGCGCAGCCCTGAACCAGTCACGTAGCGCTAGCGGAGTGTATACTGGCTTA

Visualization of oriT structure

  oriT secondary structure

Predicted by RNAfold.

Download structure file


Host bacterium


ID   1886 GenBank   NZ_JAHBNM010000007
Plasmid name   pCRE11_5 Incompatibility group   Col440I
Plasmid size   6609 bp Coordinate of oriT [Strand]   845..904 [-]
Host baterium   Klebsiella variicola strain S11_CRE11

Cargo genes


Drug resistance gene   -
Virulence gene   -
Metal resistance gene   -
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   -