Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 101436 |
| Name | oriT_pCRE26_3  |
| Organism | Klebsiella pneumoniae strain S26_CRE26 |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | NZ_JAHBNU010000013 (84..132 [-], 49 nt) |
| oriT length | 49 nt |
| IRs (inverted repeats) | 6..13, 16..23 (GCAAAATT..AATTTTGC) |
| Location of nic site | 32..33 |
| Conserved sequence flanking the nic site |
TGTGTGGTGA |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 49 nt
>oriT_pCRE26_3
AATCTGCAAAATTTTAATTTTGCGTAGTGTGTGGTGATTTTGTGGTGAG
AATCTGCAAAATTTTAATTTTGCGTAGTGTGTGGTGATTTTGTGGTGAG
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
Host bacterium
| ID | 1880 | GenBank | NZ_JAHBNU010000013 |
| Plasmid name | pCRE26_3 | Incompatibility group | - |
| Plasmid size | 2229 bp | Coordinate of oriT [Strand] | 84..132 [-] |
| Host baterium | Klebsiella pneumoniae strain S26_CRE26 |
Cargo genes
| Drug resistance gene | - |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |