Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 101435 |
| Name | oriT_pCRE26_3  |
| Organism | Klebsiella pneumoniae strain S26_CRE26 |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | NZ_JAHBNU010000006 (28951..28999 [-], 49 nt) |
| oriT length | 49 nt |
| IRs (inverted repeats) | 6..13, 16..23 (GCAAAATT..AATTTTGC) |
| Location of nic site | 32..33 |
| Conserved sequence flanking the nic site |
GGTGTGGTGA |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 49 nt
>oriT_pCRE26_3
AATCTGCAAAATTTTAATTTTGCGTGGGGTGTGGTGATTTTGTGGTGAG
AATCTGCAAAATTTTAATTTTGCGTGGGGTGTGGTGATTTTGTGGTGAG
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
T4SS
T4SS were predicted by using oriTfinder2.
Region 1: 31376..55483
| Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
|---|---|---|---|---|---|---|
| KIN64_RS29310 (KIN64_29170) | 27819..28361 | + | 543 | WP_020804853 | antirestriction protein | - |
| KIN64_RS29315 (KIN64_29175) | 28384..28806 | - | 423 | WP_020315406 | transglycosylase SLT domain-containing protein | - |
| KIN64_RS29320 (KIN64_29180) | 29312..29704 | + | 393 | WP_022644939 | conjugal transfer relaxosome DNA-binding protein TraM | - |
| KIN64_RS29325 (KIN64_29185) | 29939..30640 | + | 702 | WP_022644938 | hypothetical protein | - |
| KIN64_RS29330 (KIN64_29190) | 30725..30925 | + | 201 | WP_032072063 | TraY domain-containing protein | - |
| KIN64_RS29335 (KIN64_29195) | 30994..31362 | + | 369 | WP_049119109 | type IV conjugative transfer system pilin TraA | - |
| KIN64_RS29340 (KIN64_29200) | 31376..31681 | + | 306 | WP_004178059 | type IV conjugative transfer system protein TraL | traL |
| KIN64_RS29345 (KIN64_29205) | 31701..32267 | + | 567 | WP_004194424 | type IV conjugative transfer system protein TraE | traE |
| KIN64_RS29350 (KIN64_29210) | 32254..32994 | + | 741 | WP_020804840 | type-F conjugative transfer system secretin TraK | traK |
| KIN64_RS29355 (KIN64_29215) | 32994..34418 | + | 1425 | WP_119173784 | F-type conjugal transfer pilus assembly protein TraB | traB |
| KIN64_RS29360 (KIN64_29220) | 34411..35007 | + | 597 | WP_023316398 | conjugal transfer pilus-stabilizing protein TraP | - |
| KIN64_RS29365 (KIN64_29225) | 35030..35599 | + | 570 | WP_023316399 | type IV conjugative transfer system lipoprotein TraV | traV |
| KIN64_RS29370 (KIN64_29230) | 35731..36141 | + | 411 | WP_020805613 | hypothetical protein | - |
| KIN64_RS29375 (KIN64_29235) | 36146..36430 | + | 285 | WP_119173789 | hypothetical protein | - |
| KIN64_RS29380 (KIN64_29240) | 36454..36672 | + | 219 | WP_119173783 | hypothetical protein | - |
| KIN64_RS29385 (KIN64_29245) | 36673..36984 | + | 312 | WP_100698965 | hypothetical protein | - |
| KIN64_RS29390 (KIN64_29250) | 37051..37455 | + | 405 | WP_049246239 | hypothetical protein | - |
| KIN64_RS29395 (KIN64_29255) | 37452..37742 | + | 291 | WP_101975967 | hypothetical protein | - |
| KIN64_RS29400 (KIN64_29260) | 37750..38148 | + | 399 | WP_162906118 | hypothetical protein | - |
| KIN64_RS29405 (KIN64_29265) | 38220..40859 | + | 2640 | WP_020323518 | type IV secretion system protein TraC | virb4 |
| KIN64_RS29410 (KIN64_29270) | 40859..41248 | + | 390 | WP_060446931 | type-F conjugative transfer system protein TrbI | - |
| KIN64_RS29415 (KIN64_29275) | 41248..41874 | + | 627 | WP_020314628 | type-F conjugative transfer system protein TraW | traW |
| KIN64_RS29420 (KIN64_29280) | 41894..42877 | + | 984 | WP_223176982 | conjugal transfer pilus assembly protein TraU | traU |
| KIN64_RS29425 (KIN64_29285) | 42892..43440 | + | 549 | WP_022631518 | hypothetical protein | - |
| KIN64_RS29430 (KIN64_29290) | 43415..44104 | - | 690 | WP_105446497 | hypothetical protein | - |
| KIN64_RS29435 (KIN64_29295) | 44161..44763 | + | 603 | WP_022631520 | hypothetical protein | - |
| KIN64_RS29440 (KIN64_29300) | 44908..45555 | + | 648 | WP_039698503 | type-F conjugative transfer system pilin assembly protein TrbC | trbC |
| KIN64_RS29445 (KIN64_29305) | 45614..47569 | + | 1956 | WP_060598862 | type-F conjugative transfer system mating-pair stabilization protein TraN | traN |
| KIN64_RS29450 (KIN64_29310) | 47602..47883 | + | 282 | WP_012540038 | hypothetical protein | - |
| KIN64_RS29455 (KIN64_29315) | 47873..48100 | + | 228 | WP_268201219 | conjugal transfer protein TrbE | - |
| KIN64_RS29460 (KIN64_29320) | 48110..48436 | + | 327 | WP_148853185 | hypothetical protein | - |
| KIN64_RS29465 (KIN64_29325) | 48459..49211 | + | 753 | WP_148853187 | type-F conjugative transfer system pilin assembly protein TraF | traF |
| KIN64_RS29470 (KIN64_29330) | 49222..49662 | + | 441 | WP_077267108 | hypothetical protein | - |
| KIN64_RS29475 (KIN64_29335) | 49625..49984 | - | 360 | WP_064386183 | hypothetical protein | - |
| KIN64_RS29480 (KIN64_29340) | 50073..50309 | + | 237 | WP_064386186 | type-F conjugative transfer system pilin chaperone TraQ | - |
| KIN64_RS29485 (KIN64_29345) | 50284..50850 | + | 567 | WP_100663597 | type-F conjugative transfer system pilin assembly thiol-disulfide isomerase TrbB | traF |
| KIN64_RS29490 (KIN64_29350) | 50843..51271 | + | 429 | WP_100663598 | conjugal transfer protein TrbF | - |
| KIN64_RS29495 (KIN64_29355) | 51258..52628 | + | 1371 | WP_064386191 | conjugal transfer pilus assembly protein TraH | traH |
| KIN64_RS29500 (KIN64_29360) | 52628..55483 | + | 2856 | WP_268201220 | conjugal transfer mating-pair stabilization protein TraG | traG |
| KIN64_RS29505 (KIN64_29365) | 55500..56171 | + | 672 | WP_088883382 | hypothetical protein | - |
| KIN64_RS29510 (KIN64_29370) | 56418..57110 | + | 693 | WP_162762153 | hypothetical protein | - |
| KIN64_RS29515 (KIN64_29375) | 57131..57394 | + | 264 | WP_162906117 | hypothetical protein | - |
Host bacterium
| ID | 1879 | GenBank | NZ_JAHBNU010000006 |
| Plasmid name | pCRE26_3 | Incompatibility group | - |
| Plasmid size | 57558 bp | Coordinate of oriT [Strand] | 28951..28999 [-] |
| Host baterium | Klebsiella pneumoniae strain S26_CRE26 |
Cargo genes
| Drug resistance gene | - |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |