Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 101423 |
| Name | oriT_pCRE9_1  |
| Organism | Klebsiella pneumoniae strain S9_CRE9 |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | NZ_JAHBNL010000002 (246379..246428 [+], 50 nt) |
| oriT length | 50 nt |
| IRs (inverted repeats) | 7..14, 17..24 (GCAAAATT..AATTTTGC) |
| Location of nic site | _ |
| Conserved sequence flanking the nic site |
_ |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 50 nt
>oriT_pCRE9_1
AAATCTGCAAAATTTTAATTTTGCGTGGGGTGTGGTCATTTTGTGGTGAG
AAATCTGCAAAATTTTAATTTTGCGTGGGGTGTGGTCATTTTGTGGTGAG
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
T4SS
T4SS were predicted by using oriTfinder2.
Region 1: 210730..221006
| Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
|---|---|---|---|---|---|---|
| KIN44_RS27525 (KIN44_27385) | 205813..206142 | - | 330 | WP_020323151 | TrfB-related DNA-binding protein | - |
| KIN44_RS27530 (KIN44_27390) | 206718..207599 | - | 882 | WP_020323144 | replication protein RepA | - |
| KIN44_RS27535 (KIN44_27395) | 207739..208071 | + | 333 | WP_020323168 | hypothetical protein | - |
| KIN44_RS27540 (KIN44_27400) | 208237..208845 | + | 609 | WP_032449362 | recombinase family protein | - |
| KIN44_RS27545 (KIN44_27405) | 208842..209027 | - | 186 | WP_006118530 | ribbon-helix-helix domain-containing protein | - |
| KIN44_RS27550 (KIN44_27410) | 209312..209620 | - | 309 | WP_032416643 | hypothetical protein | - |
| KIN44_RS27555 (KIN44_27415) | 209624..209962 | - | 339 | WP_223226685 | hypothetical protein | - |
| KIN44_RS27560 (KIN44_27420) | 209959..210309 | - | 351 | WP_032416642 | hypothetical protein | - |
| KIN44_RS27565 (KIN44_27425) | 210313..210630 | - | 318 | WP_032449361 | H-NS histone family protein | - |
| KIN44_RS27570 (KIN44_27430) | 210730..211512 | + | 783 | WP_032416587 | lytic transglycosylase domain-containing protein | virB1 |
| KIN44_RS27580 (KIN44_27435) | 211714..212055 | + | 342 | WP_001121032 | TrbC/VirB2 family protein | virB2 |
| KIN44_RS27585 (KIN44_27440) | 212095..212412 | + | 318 | WP_000462629 | VirB3 family type IV secretion system protein | virB3 |
| KIN44_RS27590 (KIN44_27445) | 212413..214986 | + | 2574 | WP_020323176 | VirB4 family type IV secretion/conjugal transfer ATPase | virb4 |
| KIN44_RS27595 (KIN44_27450) | 215002..215703 | + | 702 | WP_020323143 | type IV secretion system protein | virB5 |
| KIN44_RS27600 (KIN44_27455) | 215713..215955 | + | 243 | WP_000858958 | EexN family lipoprotein | - |
| KIN44_RS27605 (KIN44_27460) | 215972..217009 | + | 1038 | WP_020323169 | type IV secretion system protein | virB6 |
| KIN44_RS28020 | 217086..217217 | + | 132 | WP_032493177 | hypothetical protein | - |
| KIN44_RS27610 (KIN44_27465) | 217228..217923 | + | 696 | WP_001208352 | type IV secretion system protein | virB8 |
| KIN44_RS27615 (KIN44_27470) | 217934..218821 | + | 888 | WP_020323166 | TrbG/VirB9 family P-type conjugative transfer protein | virB9 |
| KIN44_RS27620 (KIN44_27475) | 218821..219954 | + | 1134 | WP_020323153 | type IV secretion system protein VirB10 | virB10 |
| KIN44_RS27625 (KIN44_27480) | 220005..221006 | + | 1002 | WP_020323165 | ATPase, T2SS/T4P/T4SS family | virB11 |
| KIN44_RS27630 (KIN44_27485) | 221063..221530 | + | 468 | WP_046092601 | phospholipase D family protein | - |
| KIN44_RS27635 (KIN44_27490) | 221527..221838 | + | 312 | WP_032416518 | hypothetical protein | - |
| KIN44_RS27640 (KIN44_27495) | 222454..222816 | - | 363 | WP_020323170 | hypothetical protein | - |
| KIN44_RS27645 (KIN44_27500) | 222809..223474 | - | 666 | WP_020323157 | DUF6710 family protein | - |
| KIN44_RS27650 (KIN44_27505) | 223471..225744 | - | 2274 | WP_267995487 | AAA family ATPase | - |
Host bacterium
| ID | 1867 | GenBank | NZ_JAHBNL010000002 |
| Plasmid name | pCRE9_1 | Incompatibility group | IncFIB |
| Plasmid size | 275153 bp | Coordinate of oriT [Strand] | 246379..246428 [+] |
| Host baterium | Klebsiella pneumoniae strain S9_CRE9 |
Cargo genes
| Drug resistance gene | dfrA14, aac(6')-Ib-cr, blaOXA-1 |
| Virulence gene | - |
| Metal resistance gene | silE, silS, silR, silC, silF, silB, silA, silP, pcoA, pcoB, pcoC, pcoD, pcoR, pcoS, pcoE, arsH, arsC, arsB, arsA, arsD, arsR, chrA, ncrA, ncrB, ncrC, ncrY |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | AcrIE9 |