Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 101421 |
| Name | oriT_Ss39|unnamed2 |
| Organism | Streptococcus suis strain Ss39 |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | NZ_JAJUWV010000004 (1974..2014 [-], 41 nt) |
| oriT length | 41 nt |
| IRs (inverted repeats) | _ |
| Location of nic site | 21..22 |
| Conserved sequence flanking the nic site |
AGTGTAGTGC |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 41 nt
>oriT_Ss39|unnamed2
CACATTTACGAAGTAAAGTGTAGTGCGTTACACTTTACATG
CACATTTACGAAGTAAAGTGTAGTGCGTTACACTTTACATG
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
Host bacterium
| ID | 1865 | GenBank | NZ_JAJUWV010000004 |
| Plasmid name | Ss39|unnamed2 | Incompatibility group | - |
| Plasmid size | 3972 bp | Coordinate of oriT [Strand] | 1974..2014 [-] |
| Host baterium | Streptococcus suis strain Ss39 |
Cargo genes
| Drug resistance gene | - |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |