Detailed information of oriT

oriT

The information of the oriT region

• oriTDB ID: 101421
• Name: oriT_Ss39|unnamed2
• Organism: Streptococcus suis strain Ss39
• Sequence Completeness: -
• NCBI accession of oriT (coordinates [strand]): NZ_JAJUWV010000004 (1974..2014 [-], 41 nt)
• oriT length: 41 nt
• IRs (inverted repeats): _
• Location of nic site: 21..22
• Conserved sequence flanking the nic site: AGTGTAGTGC
• Note: Predicted by oriTfinder 2.0

oriT sequence

• Length: 41 nt

>oriT_Ss39|unnamed2
CACATTTACGAAGTAAAGTGTAGTGCGTTACACTTTACATG

oriT secondary structure

Predicted by RNAfold.

Host bacterium

• ID: 1865
• GenBank: NZ_JAJUWV010000004
• Plasmid name: Ss39|unnamed2
• Incompatibility group: -
• Plasmid size: 3972 bp
• Coordinate of oriT [Strand]: 1974..2014 [-]
• Host baterium: Streptococcus suis strain Ss39

Cargo genes

• Drug resistance gene: -
• Virulence gene: -
• Metal resistance gene: -
• Degradation gene: -
• Symbiosis gene: -
• Anti-CRISPR: -