Detailed information of oriT

oriT


The information of the oriT region


oriTDB ID   101421
Name   oriT_Ss39|unnamed2 in_silico
Organism   Streptococcus suis strain Ss39
Sequence Completeness      -
NCBI accession of oriT (coordinates [strand])   NZ_JAJUWV010000004 (1974..2014 [-], 41 nt)
oriT length   41 nt
IRs (inverted repeats)     _
Location of nic site      21..22
Conserved sequence flanking the
  nic site  
 
 AGTGTAGTGC
Note   Predicted by oriTfinder 2.0

  oriT sequence  


Download         Length: 41 nt

>oriT_Ss39|unnamed2
CACATTTACGAAGTAAAGTGTAGTGCGTTACACTTTACATG

Visualization of oriT structure

  oriT secondary structure

Predicted by RNAfold.

Download structure file


Host bacterium


ID   1865 GenBank   NZ_JAJUWV010000004
Plasmid name   Ss39|unnamed2 Incompatibility group   -
Plasmid size   3972 bp Coordinate of oriT [Strand]   1974..2014 [-]
Host baterium   Streptococcus suis strain Ss39

Cargo genes


Drug resistance gene   -
Virulence gene   -
Metal resistance gene   -
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   -