Detailed information of oriT

oriT


The information of the oriT region


oriTDB ID   101414
Name   oriT_pP16E in_silico
Organism   Klebsiella pneumoniae strain P16
Sequence Completeness      -
NCBI accession of oriT (coordinates [strand])   NZ_JABENA010000007 (1515..1565 [-], 51 nt)
oriT length   51 nt
IRs (inverted repeats)      6..13, 16..23  (GCAAAATT..AATTTTGC)
Location of nic site      _
Conserved sequence flanking the
  nic site  
 
 _
Note   Predicted by oriTfinder 2.0

  oriT sequence  


Download         Length: 51 nt

>oriT_pP16E
AATCTGCAAAATTTTAATTTTGCGTGGGGTGTGGGTATTTTTAGTGGTGAG

Visualization of oriT structure

  oriT secondary structure

Predicted by RNAfold.

Download structure file


Host bacterium


ID   1858 GenBank   NZ_JABENA010000007
Plasmid name   pP16E Incompatibility group   Col440I
Plasmid size   4167 bp Coordinate of oriT [Strand]   1515..1565 [-]
Host baterium   Klebsiella pneumoniae strain P16

Cargo genes


Drug resistance gene   -
Virulence gene   -
Metal resistance gene   -
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   -