Detailed information of oriT

oriT

The information of the oriT region

• oriTDB ID: 101409
• Name: oriT_EPA165|unnamed
• Organism: Escherichia coli strain EPA165
• Sequence Completeness: -
• NCBI accession of oriT (coordinates [strand]): NZ_SJTD01000036 (2756..2815 [+], 60 nt)
• oriT length: 60 nt
• IRs (inverted repeats): _
• Location of nic site: _
• Conserved sequence flanking the nic site: _
• Note: Predicted by oriTfinder 2.0

oriT sequence

• Length: 60 nt

>oriT_EPA165|unnamed
GGGTTTCGGGGCGAAGCCCTGAACCAGTCACGTAGCGATAGCGGAGTGTATACTGGCTTA

oriT secondary structure

Predicted by RNAfold.

Host bacterium

• ID: 1853
• GenBank: NZ_SJTD01000036
• Plasmid name: EPA165|unnamed
• Incompatibility group: ColRNAI
• Plasmid size: 4936 bp
• Coordinate of oriT [Strand]: 2756..2815 [+]
• Host baterium: Escherichia coli strain EPA165

Cargo genes

• Drug resistance gene: -
• Virulence gene: -
• Metal resistance gene: -
• Degradation gene: -
• Symbiosis gene: -
• Anti-CRISPR: -