Detailed information of oriT

oriT


The information of the oriT region


oriTDB ID   101395
Name   oriT_p1566m1_B in_silico
Organism   Escherichia coli strain 1566m1
Sequence Completeness      -
NCBI accession of oriT (coordinates [strand])   NZ_JAJHPW010000003 (42329..42613 [-], 285 nt)
oriT length   285 nt
IRs (inverted repeats)      184..189, 191..196  (AAAAGT..ACTTTT)
Location of nic site      109..110
Conserved sequence flanking the
  nic site  
 
 TTTGGTTAAA
Note   Predicted by oriTfinder 2.0

  oriT sequence  


Download         Length: 285 nt

>oriT_p1566m1_B
GGTTATTGCTACTTAATGCCGATAACGACTCAGGCTTTGAGGTTTTTTTATACGGTTCACATTTCGTTAGCAAGGTCAGGGTTTTTTGATAAAATTCTGGTTAGTTTGGTTAAAAAGTGTTACAAGTATGGGTAATGGCTGAAAGGTTAGTTTTAAGGTTCAAAGCGGCAGTATTAAAATTCCAAAAGTTACTTTTCATCCTTCAGAATCCAGACCTTAATTTCATGTAGAAGATTCGTACAATTGTATTGGCGCAAGGACAATCCGCACATGTCAGAATCAGAT

Visualization of oriT structure

  oriT secondary structure

Predicted by RNAfold.

Download structure file


Host bacterium


ID   1839 GenBank   NZ_JAJHPW010000003
Plasmid name   p1566m1_B Incompatibility group   IncFIB
Plasmid size   186335 bp Coordinate of oriT [Strand]   42329..42613 [-]
Host baterium   Escherichia coli strain 1566m1

Cargo genes


Drug resistance gene   sul1, qacE, catB3, blaIMP-38, blaSHV-12, blaTEM-1B, aac(3)-IId, mph(A)
Virulence gene   -
Metal resistance gene   -
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   -