Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 101376 |
| Name | oriT_pIT-14519  |
| Organism | Klebsiella pneumoniae subsp. pneumoniae strain KP-14519 |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | NZ_VRSA01000004 (64233..64282 [+], 50 nt) |
| oriT length | 50 nt |
| IRs (inverted repeats) | 7..14, 17..24 (GCAAAATT..AATTTTGC) |
| Location of nic site | 33..34 |
| Conserved sequence flanking the nic site |
GGTGTGGTGA |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 50 nt
>oriT_pIT-14519
AAATCTGCAAAATTTTAATTTTGCGTGGGGTGTGGTGATTTTGTGGTGAG
AAATCTGCAAAATTTTAATTTTGCGTGGGGTGTGGTGATTTTGTGGTGAG
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
T4SS
T4SS were predicted by using oriTfinder2.
Region 1: 58034..64840
| Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
|---|---|---|---|---|---|---|
| FVO60_RS28670 (FVO60_28390) | 53870..55585 | + | 1716 | WP_004152391 | Tn3-like element Tn4401 family resolvase TnpR | - |
| FVO60_RS28675 | 55880..56035 | + | 156 | WP_001404092 | hypothetical protein | - |
| FVO60_RS28680 (FVO60_28395) | 56084..57076 | + | 993 | WP_001145103 | hypothetical protein | - |
| FVO60_RS28685 | 57133..57264 | + | 132 | Protein_60 | ISNCY family transposase | - |
| FVO60_RS28690 (FVO60_28400) | 57492..57902 | - | 411 | WP_004152499 | hypothetical protein | - |
| FVO60_RS28695 (FVO60_28405) | 58034..58618 | - | 585 | WP_004161368 | type IV conjugative transfer system lipoprotein TraV | traV |
| FVO60_RS28700 (FVO60_28410) | 58732..60156 | - | 1425 | WP_004155033 | F-type conjugal transfer pilus assembly protein TraB | traB |
| FVO60_RS28705 (FVO60_28415) | 60156..60896 | - | 741 | WP_004152497 | type-F conjugative transfer system secretin TraK | traK |
| FVO60_RS28710 (FVO60_28420) | 60883..61449 | - | 567 | WP_004144423 | type IV conjugative transfer system protein TraE | traE |
| FVO60_RS28715 (FVO60_28425) | 61469..61774 | - | 306 | WP_004144424 | type IV conjugative transfer system protein TraL | traL |
| FVO60_RS28720 (FVO60_28430) | 61788..62156 | - | 369 | WP_004152496 | type IV conjugative transfer system pilin TraA | - |
| FVO60_RS28725 (FVO60_28435) | 62210..62596 | - | 387 | WP_004152495 | TraY domain-containing protein | - |
| FVO60_RS28730 (FVO60_28440) | 62675..63361 | - | 687 | WP_004152494 | transcriptional regulator TraJ family protein | - |
| FVO60_RS28735 (FVO60_28445) | 63535..63933 | - | 399 | WP_004152493 | conjugal transfer relaxosome DNA-binding protein TraM | - |
| FVO60_RS28740 (FVO60_28450) | 64355..64840 | + | 486 | WP_001568108 | transglycosylase SLT domain-containing protein | virB1 |
| FVO60_RS28745 (FVO60_28455) | 64873..65202 | - | 330 | WP_011977736 | DUF5983 family protein | - |
| FVO60_RS28750 (FVO60_28460) | 65235..66056 | - | 822 | WP_004152492 | DUF932 domain-containing protein | - |
| FVO60_RS28765 (FVO60_28470) | 66876..67709 | - | 834 | WP_004152751 | N-6 DNA methylase | - |
| FVO60_RS28770 (FVO60_28475) | 67760..67906 | - | 147 | WP_004152750 | hypothetical protein | - |
| FVO60_RS28775 (FVO60_28480) | 68001..68348 | - | 348 | WP_004152749 | hypothetical protein | - |
| FVO60_RS28780 (FVO60_28485) | 68405..68758 | - | 354 | WP_004152748 | hypothetical protein | - |
| FVO60_RS28795 (FVO60_28495) | 69388..69738 | - | 351 | WP_004153414 | hypothetical protein | - |
Host bacterium
| ID | 1820 | GenBank | NZ_VRSA01000004 |
| Plasmid name | pIT-14519 | Incompatibility group | IncFIB |
| Plasmid size | 88674 bp | Coordinate of oriT [Strand] | 64233..64282 [+] |
| Host baterium | Klebsiella pneumoniae subsp. pneumoniae strain KP-14519 |
Cargo genes
| Drug resistance gene | blaKPC-3, blaOXA-9, aac(6')-Ib |
| Virulence gene | - |
| Metal resistance gene | merA, merD, merE |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | AcrIE9 |