Detailed information of oriT

oriT


The information of the oriT region


oriTDB ID   101373
Name   oriT_FWSEC0437|unnamed1 in_silico
Organism   Escherichia coli strain FWSEC0437
Sequence Completeness      -
NCBI accession of oriT (coordinates [strand])   NZ_RRPF01000150 (1669..1728 [+], 60 nt)
oriT length   60 nt
IRs (inverted repeats)     _
Location of nic site      _
Conserved sequence flanking the
  nic site  
 
 _
Note   Predicted by oriTfinder 2.0

  oriT sequence  


Download         Length: 60 nt

>oriT_FWSEC0437|unnamed1
GGGTGTCGGGGCGCAGCCCTGACCCAGTCACGTAGCGATAGCGGAATGTATACTGGCTTA

Visualization of oriT structure

  oriT secondary structure

Predicted by RNAfold.

Download structure file


Host bacterium


ID   1817 GenBank   NZ_RRPF01000150
Plasmid name   FWSEC0437|unnamed1 Incompatibility group   ColRNAI
Plasmid size   5553 bp Coordinate of oriT [Strand]   1669..1728 [+]
Host baterium   Escherichia coli strain FWSEC0437

Cargo genes


Drug resistance gene   -
Virulence gene   -
Metal resistance gene   -
Degradation gene   -
Symbiosis gene   -
Anti-CRISPR   -