Detailed information of oriT
oriT
The information of the oriT region
| oriTDB ID | 101372 |
| Name | oriT_AqSCr|unnamed13  |
| Organism | Klebsiella sp. AqSCr |
| Sequence Completeness | - |
| NCBI accession of oriT (coordinates [strand]) | NZ_MJDM01000015 (1908..1957 [-], 50 nt) |
| oriT length | 50 nt |
| IRs (inverted repeats) | 7..14, 17..24 (GCAAAATT..AATTTTGC) |
| Location of nic site | _ |
| Conserved sequence flanking the nic site |
_ |
| Note | Predicted by oriTfinder 2.0 |
oriT sequence
Download Length: 50 nt
>oriT_AqSCr|unnamed13
AAATCTGCAAAATTTTAATTTTGCGTAGTGTGTGGTCATTTTGTGGTGAG
AAATCTGCAAAATTTTAATTTTGCGTAGTGTGTGGTCATTTTGTGGTGAG
Visualization of oriT structure
oriT secondary structure
Predicted by RNAfold.
Download structure file
T4SS
T4SS were predicted by using oriTfinder2.
Region 1: 1350..8567
| Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
|---|---|---|---|---|---|---|
| BHE81_RS25445 (BHE81_26110) | 134..955 | + | 822 | WP_004182076 | DUF932 domain-containing protein | - |
| BHE81_RS25450 | 988..1317 | + | 330 | WP_011977736 | DUF5983 family protein | - |
| BHE81_RS25455 (BHE81_26115) | 1350..1835 | - | 486 | WP_004178063 | transglycosylase SLT domain-containing protein | virB1 |
| BHE81_RS25460 (BHE81_26120) | 2226..2642 | + | 417 | WP_072145360 | conjugal transfer relaxosome DNA-binding protein TraM | - |
| BHE81_RS25465 (BHE81_26125) | 2842..3561 | + | 720 | WP_016831034 | conjugal transfer protein TrbJ | - |
| BHE81_RS25470 (BHE81_26130) | 3694..3900 | + | 207 | WP_171773970 | TraY domain-containing protein | - |
| BHE81_RS25475 (BHE81_26135) | 3962..4330 | + | 369 | WP_004194426 | type IV conjugative transfer system pilin TraA | - |
| BHE81_RS25480 (BHE81_26140) | 4344..4649 | + | 306 | WP_004144424 | type IV conjugative transfer system protein TraL | traL |
| BHE81_RS25485 (BHE81_26145) | 4669..5235 | + | 567 | WP_004144423 | type IV conjugative transfer system protein TraE | traE |
| BHE81_RS25490 (BHE81_26150) | 5222..5962 | + | 741 | WP_013214019 | type-F conjugative transfer system secretin TraK | traK |
| BHE81_RS25495 (BHE81_26155) | 5962..7386 | + | 1425 | WP_149888847 | F-type conjugal transfer pilus assembly protein TraB | traB |
| BHE81_RS25500 (BHE81_26160) | 7379..7975 | + | 597 | WP_040172382 | conjugal transfer pilus-stabilizing protein TraP | - |
| BHE81_RS25505 (BHE81_26165) | 7998..8567 | + | 570 | WP_023316399 | type IV conjugative transfer system lipoprotein TraV | traV |
Host bacterium
| ID | 1816 | GenBank | NZ_MJDM01000015 |
| Plasmid name | AqSCr|unnamed13 | Incompatibility group | - |
| Plasmid size | 8569 bp | Coordinate of oriT [Strand] | 1908..1957 [-] |
| Host baterium | Klebsiella sp. AqSCr |
Cargo genes
| Drug resistance gene | - |
| Virulence gene | - |
| Metal resistance gene | - |
| Degradation gene | - |
| Symbiosis gene | - |
| Anti-CRISPR | - |